Exon Sequence
>ENSE00001079949 NT
CTCCCTTGCCTCAGCTCCTA
TGATAGCTACTGCAGCAATC
AAGTAGCCGCCAAAGCTCTG
CTGGACCACAAAAAGCAAGA
TCACCGAGTCCAGGATTTCC
TACAGCGATGTTTAGAATCC
CCCTTTAGCCGCAAACTAGA
TCTCTGGAATTTCCTCGATA
TTCCAAGAAGCCGCCTGGTA
AAATACCCTCTGCTTCTCCG
AGAAATCTTGAGGCACACAC
CAAATGATAATCCAGATCAG
CAGCACTTGGAAGAAGCT
>ENSE00001079949 AA
LPCLSSYDSYCSNQVAAKAL
LDHKKQDHRVQDFLQRCLES
PFSRKLDLWNFLDIPRSRLV
KYPLLLREILRHTPNDNPDQ
QHLEEA

ENSE00001079949

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003059703 reads Identity : 100%

-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-
CTCCCTTGCCTCAGCTCCTATGATAGCTACTGCAGCAATCAAGTAGCCGCCAAAGCTCTGCTGGACCACAAAAAGCAAGATCACCGAGTC
::::::::.::.:::::::::::.:::::::::::::::::::::::.:::::.:::::::::::::::::.::.:::::::::::::::
CTCCCTTGTCTTAGCTCCTATGACAGCTACTGCAGCAATCAAGTAGCTGCCAAGGCTCTGCTGGACCACAAGAAACAAGATCACCGAGTC
-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-

-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-
CAGGATTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTCGATATTCCAAGAAGCCGCCTGGTA
::.::.:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::.:::::::::::::::::.:::::.
CAAGACTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTTGATATTCCAAGAAGCCGTCTGGTG
-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-

-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-
AAATACCCTCTGCTTCTCCGAGAAATCTTGAGGCACACACCAAATGATAATCCAGATCAGCAGCACTTGGAAGAAGCT
:::::::::::::::::.:::::::::::::::::::::::.::::::::::::::::::::::::.:::::::::::
AAATACCCTCTGCTTCTTCGAGAAATCTTGAGGCACACACCGAATGATAATCCAGATCAGCAGCACCTGGAAGAAGCT
-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-

BGISUSX0002097652 est Identity : 100%

-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-
CTCCCTTGCCTCAGCTCCTATGATAGCTACTGCAGCAATCAAGTAGCCGCCAAAGCTCTGCTGGACCACAAAAAGCAAGATCACCGAGTC
::::::::.::.:::::::::::.:::::::::::::::::::::::.:::::.:::::::::::::::::.::.:::::::::::::::
CTCCCTTGTCTTAGCTCCTATGACAGCTACTGCAGCAATCAAGTAGCTGCCAAGGCTCTGCTGGACCACAAGAAACAAGATCACCGAGTC
-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-

-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-
CAGGATTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTCGATATTCCAAGAAGCCGCCTGGTA
::.::.:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::.:::::::::::::::::.:::::.
CAAGACTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTTGATATTCCAAGAAGCCGTCTGGTG
-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-

-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-
AAATACCCTCTGCTTCTCCGAGAAATCTTGAGGCACACACCAAATGATAATCCAGATCAGCAGCACTTGGAAGAAGCT
:::::::::::::::::.:::::::::::::::::::::::.::::::::::::::::::::::::.:::::::::::
AAATACCCTCTGCTTCTTCGAGAAATCTTGAGGCACACACCGAATGATAATCCAGATCAGCAGCACCTGGAAGAAGCT
-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-

BGISUSX0002097653 est Identity : 100%

-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-
CTCCCTTGCCTCAGCTCCTATGATAGCTACTGCAGCAATCAAGTAGCCGCCAAAGCTCTGCTGGACCACAAAAAGCAAGATCACCGAGTC
::::::::.::.:::::::::::.::::::::::::::::::                                                
CTCCCTTGTCTTAGCTCCTATGACAGCTACTGCAGCAATCAA                                                
-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q-------------------------------------------------

-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-
CAGGATTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTCGATATTCCAAGAAGCCGCCTGGTA
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-
AAATACCCTCTGCTTCTCCGAGAAATCTTGAGGCACACACCAAATGATAATCCAGATCAGCAGCACTTGGAAGAAGCT
                                                                              
                                                                              
------------------------------------------------------------------------------

BGISUSX0001138535 both Identity : 100%

-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-
CTCCCTTGCCTCAGCTCCTATGATAGCTACTGCAGCAATCAAGTAGCCGCCAAAGCTCTGCTGGACCACAAAAAGCAAGATCACCGAGTC
::::::::.::.:::::::::::.:::::::::::::::::::::::.:::::.:::::::::::::::::.::.:::::::::::::::
CTCCCTTGTCTTAGCTCCTATGACAGCTACTGCAGCAATCAAGTAGCTGCCAAGGCTCTGCTGGACCACAAGAAACAAGATCACCGAGTC
-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-

-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-
CAGGATTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTCGATATTCCAAGAAGCCGCCTGGTA
::.::.:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::.:::::::::::::::::.:::::.
CAAGACTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTTGATATTCCAAGAAGCCGTCTGGTG
-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-

-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-
AAATACCCTCTGCTTCTCCGAGAAATCTTGAGGCACACACCAAATGATAATCCAGATCAGCAGCACTTGGAAGAAGCT
:::::::::::::::::.:::::::::::::::::::::::.::::::::::::::::::::::::.:::::::::::
AAATACCCTCTGCTTCTTCGAGAAATCTTGAGGCACACACCGAATGATAATCCAGATCAGCAGCACCTGGAAGAAGCT
-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-

BGISUSX0001138536 both Identity : 100%

-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-
CTCCCTTGCCTCAGCTCCTATGATAGCTACTGCAGCAATCAAGTAGCCGCCAAAGCTCTGCTGGACCACAAAAAGCAAGATCACCGAGTC
::::::::.::.:::::::::::.::::::::::::::::::                                                
CTCCCTTGTCTTAGCTCCTATGACAGCTACTGCAGCAATCAA                                                
-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q-------------------------------------------------

-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-
CAGGATTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTCGATATTCCAAGAAGCCGCCTGGTA
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-
AAATACCCTCTGCTTCTCCGAGAAATCTTGAGGCACACACCAAATGATAATCCAGATCAGCAGCACTTGGAAGAAGCT
                                                                              
                                                                              
------------------------------------------------------------------------------

BGISUSX0000179894 all Identity : 100%

-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-
CTCCCTTGCCTCAGCTCCTATGATAGCTACTGCAGCAATCAAGTAGCCGCCAAAGCTCTGCTGGACCACAAAAAGCAAGATCACCGAGTC
::::::::.::.:::::::::::.:::::::::::::::::::::::.:::::.:::::::::::::::::.::.:::::::::::::::
CTCCCTTGTCTTAGCTCCTATGACAGCTACTGCAGCAATCAAGTAGCTGCCAAGGCTCTGCTGGACCACAAGAAACAAGATCACCGAGTC
-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-

-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-
CAGGATTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTCGATATTCCAAGAAGCCGCCTGGTA
::.::.:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::.:::::::::::::::::.:::::.
CAAGACTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTTGATATTCCAAGAAGCCGTCTGGTG
-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-

-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-
AAATACCCTCTGCTTCTCCGAGAAATCTTGAGGCACACACCAAATGATAATCCAGATCAGCAGCACTTGGAAGAAGCT
:::::::::::::::::.:::::::::::::::::::::::.::::::::::::::::::::::::.:::::::::::
AAATACCCTCTGCTTCTTCGAGAAATCTTGAGGCACACACCGAATGATAATCCAGATCAGCAGCACCTGGAAGAAGCT
-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-

BGISUSX0000179895 all Identity : 100%

-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-
CTCCCTTGCCTCAGCTCCTATGATAGCTACTGCAGCAATCAAGTAGCCGCCAAAGCTCTGCTGGACCACAAAAAGCAAGATCACCGAGTC
::::::::.::.:::::::::::.::::::::::::::::::                                                
CTCCCTTGTCTTAGCTCCTATGACAGCTACTGCAGCAATCAA                                                
-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q-------------------------------------------------

-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-
CAGGATTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTCGATATTCCAAGAAGCCGCCTGGTA
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-
AAATACCCTCTGCTTCTCCGAGAAATCTTGAGGCACACACCAAATGATAATCCAGATCAGCAGCACTTGGAAGAAGCT
                                                                              
                                                                              
------------------------------------------------------------------------------

BGISUSX0002097653 est Identity : 66.667%

-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-
CTCCCTTGCCTCAGCTCCTATGATAGCTACTGCAGCAATCAAGTAGCCGCCAAAGCTCTGCTGGACCACAAAAAGCAAGATCACCGAGTC
::.  ::::. :::.  :                                                                        
CTTGATTGCTGCAGTAGC                                                                        
-L--D--C--C--S--S-------------------------------------------------------------------------

-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-
CAGGATTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTCGATATTCCAAGAAGCCGCCTGGTA
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-
AAATACCCTCTGCTTCTCCGAGAAATCTTGAGGCACACACCAAATGATAATCCAGATCAGCAGCACTTGGAAGAAGCT
                                                                              
                                                                              
------------------------------------------------------------------------------

BGISUSX0001138536 both Identity : 66.667%

-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-
CTCCCTTGCCTCAGCTCCTATGATAGCTACTGCAGCAATCAAGTAGCCGCCAAAGCTCTGCTGGACCACAAAAAGCAAGATCACCGAGTC
::.  ::::. :::.  :                                                                        
CTTGATTGCTGCAGTAGC                                                                        
-L--D--C--C--S--S-------------------------------------------------------------------------

-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-
CAGGATTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTCGATATTCCAAGAAGCCGCCTGGTA
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-
AAATACCCTCTGCTTCTCCGAGAAATCTTGAGGCACACACCAAATGATAATCCAGATCAGCAGCACTTGGAAGAAGCT
                                                                              
                                                                              
------------------------------------------------------------------------------

BGISUSX0000179895 all Identity : 66.667%

-L--P--C--L--S--S--Y--D--S--Y--C--S--N--Q--V--A--A--K--A--L--L--D--H--K--K--Q--D--H--R--V-
CTCCCTTGCCTCAGCTCCTATGATAGCTACTGCAGCAATCAAGTAGCCGCCAAAGCTCTGCTGGACCACAAAAAGCAAGATCACCGAGTC
::.  ::::. :::.  :                                                                        
CTTGATTGCTGCAGTAGC                                                                        
-L--D--C--C--S--S-------------------------------------------------------------------------

-Q--D--F--L--Q--R--C--L--E--S--P--F--S--R--K--L--D--L--W--N--F--L--D--I--P--R--S--R--L--V-
CAGGATTTCCTACAGCGATGTTTAGAATCCCCCTTTAGCCGCAAACTAGATCTCTGGAATTTCCTCGATATTCCAAGAAGCCGCCTGGTA
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-K--Y--P--L--L--L--R--E--I--L--R--H--T--P--N--D--N--P--D--Q--Q--H--L--E--E--A-
AAATACCCTCTGCTTCTCCGAGAAATCTTGAGGCACACACCAAATGATAATCCAGATCAGCAGCACTTGGAAGAAGCT
                                                                              
                                                                              
------------------------------------------------------------------------------