Exon Sequence
>ENSE00001079951 NT
CTCCTTAGTCAGCTTCGAGA
TGTTAGGAAGCCTGATGGCT
CGACTGAACATGTTGGTCCC
ATCCTCGTGGGCTGG
>ENSE00001079951 AA
-LLSQLRDVRKPDGSTEHVG
PILVGW

ENSE00001079951

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0000179890 all Identity : 96.154%

-E--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
 : :::::::::::::::::::::::. :::::::::::::::::::::::::.:::::::::::.::::::::::::
GACCTCCTTAGTCAGCTTCGAGATGTCCGGAAGCCTGATGGCTCGACTGAACACGTTGGTCCCATTCTCGTGGGCTGG
-D--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-

BGISUSX0002097648 est Identity : 96%

-E--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
 : :::::::::::::::::::::::. :::::::::::::.:::::::::::.:::::::::::.:::::::::   
GACCTCCTTAGTCAGCTTCGAGATGTCCGGAAGCCTGATGGTTCGACTGAACACGTTGGTCCCATTCTCGTGGGC   
-D--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G----

BGISUSX0001138528 both Identity : 96%

-E--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
 : :::::::::::::::::::::::. :::::::::::::.:::::::::::.:::::::::::.:::::::::   
GACCTCCTTAGTCAGCTTCGAGATGTCCGGAAGCCTGATGGTTCGACTGAACACGTTGGTCCCATTCTCGTGGGC   
-D--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G----

BGISUSX0002097649 est Identity : 95.238%

-E--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
 : :::::::::::::::::::::::. :::::::::::::::::::::::::.:::::::::               
GACCTCCTTAGTCAGCTTCGAGATGTCCGGAAGCCTGATGGCTCGACTGAACACGTTGGTCCC               
-D--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P----------------

BGISUSX0001138527 both Identity : 95.238%

-E--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
 : :::::::::::::::::::::::. :::::::::::::::::::::::::.:::::::::               
GACCTCCTTAGTCAGCTTCGAGATGTCCGGAAGCCTGATGGCTCGACTGAACACGTTGGTCCC               
-D--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P----------------

BGISUSX0003059700 reads Identity : 94.118%

-E--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
 : :::::::::::::::::::::::. :::::::::::::::::::::::                           
GACCTCCTTAGTCAGCTTCGAGATGTCCGGAAGCCTGATGGCTCGACTGAA                           
-D--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E----------------------------

BGISUSX0002097650 est Identity : 94.118%

-E--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
 : :::::::::::::::::::::::. :::::::::::::::::::::::                           
GACCTCCTTAGTCAGCTTCGAGATGTCCGGAAGCCTGATGGCTCGACTGAA                           
-D--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E----------------------------

BGISUSX0001138525 both Identity : 94.118%

-E--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
 : :::::::::::::::::::::::. :::::::::::::::::::::::                           
GACCTCCTTAGTCAGCTTCGAGATGTCCGGAAGCCTGATGGCTCGACTGAA                           
-D--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E----------------------------

BGISUSX0001138526 both Identity : 94.118%

-E--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
 : :::::::::::::::::::::::. :::::::::::::::::::::::                           
GACCTCCTTAGTCAGCTTCGAGATGTCCGGAAGCCTGATGGCTCGACTGAA                           
-D--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E----------------------------

BGISUSX0000179892 all Identity : 94.118%

-E--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
 : :::::::::::::::::::::::. :::::::::::::::::::::::                           
GACCTCCTTAGTCAGCTTCGAGATGTCCGGAAGCCTGATGGCTCGACTGAA                           
-D--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E----------------------------

BGISUSX0000179891 all Identity : 93.75%

-E--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
 : :::::::::::::::::::::::. ::::::::::::::::::::                              
GACCTCCTTAGTCAGCTTCGAGATGTCCGGAAGCCTGATGGCTCGACT                              
-D--L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T-------------------------------

BGISUSX0003059700 reads Identity : 55.556%

----L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
                  :::: ..:.:::   :: ::.. ::::                                 
                  CGAGCCATCAGGCTTCCGGACATCTCG                                 
-------------------R--A--I--R--L--P--D--I--S----------------------------------

BGISUSX0002097648 est Identity : 55.556%

----L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
                  :::. ..:.:::   :: ::.. ::::                                 
                  CGAACCATCAGGCTTCCGGACATCTCG                                 
-------------------R--T--I--R--L--P--D--I--S----------------------------------

BGISUSX0002097649 est Identity : 55.556%

----L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
                  :::: ..:.:::   :: ::.. ::::                                 
                  CGAGCCATCAGGCTTCCGGACATCTCG                                 
-------------------R--A--I--R--L--P--D--I--S----------------------------------

BGISUSX0002097650 est Identity : 55.556%

----L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
                  :::: ..:.:::   :: ::.. ::::                                 
                  CGAGCCATCAGGCTTCCGGACATCTCG                                 
-------------------R--A--I--R--L--P--D--I--S----------------------------------

BGISUSX0001138525 both Identity : 55.556%

----L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
                  :::: ..:.:::   :: ::.. ::::                                 
                  CGAGCCATCAGGCTTCCGGACATCTCG                                 
-------------------R--A--I--R--L--P--D--I--S----------------------------------

BGISUSX0001138526 both Identity : 55.556%

----L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
                  :::: ..:.:::   :: ::.. ::::                                 
                  CGAGCCATCAGGCTTCCGGACATCTCG                                 
-------------------R--A--I--R--L--P--D--I--S----------------------------------

BGISUSX0001138527 both Identity : 55.556%

----L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
                  :::: ..:.:::   :: ::.. ::::                                 
                  CGAGCCATCAGGCTTCCGGACATCTCG                                 
-------------------R--A--I--R--L--P--D--I--S----------------------------------

BGISUSX0001138528 both Identity : 55.556%

----L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
                  :::. ..:.:::   :: ::.. ::::                                 
                  CGAACCATCAGGCTTCCGGACATCTCG                                 
-------------------R--T--I--R--L--P--D--I--S----------------------------------

BGISUSX0000179890 all Identity : 55.556%

----L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
                  :::: ..:.:::   :: ::.. ::::                                 
                  CGAGCCATCAGGCTTCCGGACATCTCG                                 
-------------------R--A--I--R--L--P--D--I--S----------------------------------

BGISUSX0000179891 all Identity : 55.556%

----L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
                  :::: ..:.:::   :: ::.. ::::                                 
                  CGAGCCATCAGGCTTCCGGACATCTCG                                 
-------------------R--A--I--R--L--P--D--I--S----------------------------------

BGISUSX0000179892 all Identity : 55.556%

----L--L--S--Q--L--R--D--V--R--K--P--D--G--S--T--E--H--V--G--P--I--L--V--G--W-
-AGCTCCTTAGTCAGCTTCGAGATGTTAGGAAGCCTGATGGCTCGACTGAACATGTTGGTCCCATCCTCGTGGGCTGG
                  :::: ..:.:::   :: ::.. ::::                                 
                  CGAGCCATCAGGCTTCCGGACATCTCG                                 
-------------------R--A--I--R--L--P--D--I--S----------------------------------