Exon Sequence
>ENSE00001079954 NT
CGCTCCATTAGCTTCCGCAG
TGAGAGCCGCCCTGACATCC
TCGCCCCCCGACCCTGGTCC
AGAAATGCCGCCCCCTCGAG
CACGAAACGGAGAGATAGCA
AGCTGTGGAGTGAGACCTTC
GATGTGTGCGTCAATCAGAT
GCTTACATCCAAGGAAATCA
AACGTCAGGAG
>ENSE00001079954 AA
RSISFRSESRPDILAPRPWS
RNAAPSSTKRRDSKLWSETF
DVCVNQMLTSKEIKRQE

ENSE00001079954

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002097638 est Identity : 98.246%

-R--S--I--S--F--R--S--E--S--R--P--D--I--L--A--P--R--P--W--S--R--N--A--A--P--S--S--T--K--R-
CGCTCCATTAGCTTCCGCAGTGAGAGCCGCCCTGACATCCTCGCCCCCCGACCCTGGTCCAGAAATGCCGCCCCCTCGAGCACGAAACGG
::::::::.:::::::: ::.:::::::: :::::::::::::::::: ::::::::::::::::::::::::::::.:::::.::::::
CGCTCCATCAGCTTCCGAAGCGAGAGCCGGCCTGACATCCTCGCCCCCAGACCCTGGTCCAGAAATGCCGCCCCCTCAAGCACAAAACGG
-R--S--I--S--F--R--S--E--S--R--P--D--I--L--A--P--R--P--W--S--R--N--A--A--P--S--S--T--K--R-

-R--D--S--K--L--W--S--E--T--F--D--V--C--V--N--Q--M--L--T--S--K--E--I--K--R--Q--E-
AGAGATAGCAAGCTGTGGAGTGAGACCTTCGATGTGTGCGTCAATCAGATGCTTACATCCAAGGAAATCAAACGTCAGGAG
:::::.::::::::  ::::::::::::::::::::::.::::::::::::::::::::::::::::::::::::::::::
AGAGACAGCAAGCTTGGGAGTGAGACCTTCGATGTGTGTGTCAATCAGATGCTTACATCCAAGGAAATCAAACGTCAGGAG
-R--D--S--K--L--G--S--E--T--F--D--V--C--V--N--Q--M--L--T--S--K--E--I--K--R--Q--E-

BGISUSX0001138509 both Identity : 98.246%

-R--S--I--S--F--R--S--E--S--R--P--D--I--L--A--P--R--P--W--S--R--N--A--A--P--S--S--T--K--R-
CGCTCCATTAGCTTCCGCAGTGAGAGCCGCCCTGACATCCTCGCCCCCCGACCCTGGTCCAGAAATGCCGCCCCCTCGAGCACGAAACGG
::::::::.:::::::: ::.:::::::: :::::::::::::::::: ::::::::::::::::::::::::::::.:::::.::::::
CGCTCCATCAGCTTCCGAAGCGAGAGCCGGCCTGACATCCTCGCCCCCAGACCCTGGTCCAGAAATGCCGCCCCCTCAAGCACAAAACGG
-R--S--I--S--F--R--S--E--S--R--P--D--I--L--A--P--R--P--W--S--R--N--A--A--P--S--S--T--K--R-

-R--D--S--K--L--W--S--E--T--F--D--V--C--V--N--Q--M--L--T--S--K--E--I--K--R--Q--E-
AGAGATAGCAAGCTGTGGAGTGAGACCTTCGATGTGTGCGTCAATCAGATGCTTACATCCAAGGAAATCAAACGTCAGGAG
:::::.::::::::  ::::::::::::::::::::::.::::::::::::::::::::::::::::::::::::::::::
AGAGACAGCAAGCTTGGGAGTGAGACCTTCGATGTGTGTGTCAATCAGATGCTTACATCCAAGGAAATCAAACGTCAGGAG
-R--D--S--K--L--G--S--E--T--F--D--V--C--V--N--Q--M--L--T--S--K--E--I--K--R--Q--E-

BGISUSX0000179874 all Identity : 98.246%

-R--S--I--S--F--R--S--E--S--R--P--D--I--L--A--P--R--P--W--S--R--N--A--A--P--S--S--T--K--R-
CGCTCCATTAGCTTCCGCAGTGAGAGCCGCCCTGACATCCTCGCCCCCCGACCCTGGTCCAGAAATGCCGCCCCCTCGAGCACGAAACGG
::::::::.:::::::: ::.:::::::: :::::::::::::::::: ::::::::::::::::::::::::::::.:::::.::::::
CGCTCCATCAGCTTCCGAAGCGAGAGCCGGCCTGACATCCTCGCCCCCAGACCCTGGTCCAGAAATGCCGCCCCCTCAAGCACAAAACGG
-R--S--I--S--F--R--S--E--S--R--P--D--I--L--A--P--R--P--W--S--R--N--A--A--P--S--S--T--K--R-

-R--D--S--K--L--W--S--E--T--F--D--V--C--V--N--Q--M--L--T--S--K--E--I--K--R--Q--E-
AGAGATAGCAAGCTGTGGAGTGAGACCTTCGATGTGTGCGTCAATCAGATGCTTACATCCAAGGAAATCAAACGTCAGGAG
:::::.::::::::  ::::::::::::::::::::::.::::::::::::::::::::::::::::::::::::::::::
AGAGACAGCAAGCTTGGGAGTGAGACCTTCGATGTGTGTGTCAATCAGATGCTTACATCCAAGGAAATCAAACGTCAGGAG
-R--D--S--K--L--G--S--E--T--F--D--V--C--V--N--Q--M--L--T--S--K--E--I--K--R--Q--E-