Exon Sequence
>ENSE00001079955 NT
AAACTGCATGTTTTCCTGTT
CCAAGAAGTGCTTGTGATCA
CTCGAGCCGTCACCCACAAT
GAGCAGCTTTGCTACCAGCT
GTACCGTCAGCCAATCCCCG
TGAAAGACCTCCTGCTGGAA
GACCTCCAGGATGGAGAAGT
GAGGCTGGGTGGCTCCCTGC
GAGGGGCATTCAGCAACAAT
GAGAGA
>ENSE00001079955 AA
KLHVFLFQEVLVITRAVTHN
EQLCYQLYRQPIPVKDLLLE
DLQDGEVRLGGSLRGAFSNN
ER

ENSE00001079955

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003059704 reads Identity : 100%

-K--L--H--V--F--L--F--Q--E--V--L--V--I--T--R--A--V--T--H--N--E--Q--L--C--Y--Q--L--Y--R--Q-
AAACTGCATGTTTTCCTGTTCCAAGAAGTGCTTGTGATCACTCGAGCCGTCACCCACAATGAGCAGCTTTGCTACCAGCTGTACCGTCAG
::::::::::::::::: ::::::::::::::::::::::::::::::::::::::::::::.:::::.:::::::::.::::::: :::
AAACTGCATGTTTTCCTCTTCCAAGAAGTGCTTGTGATCACTCGAGCCGTCACCCACAATGAACAGCTCTGCTACCAGTTGTACCGACAG
-K--L--H--V--F--L--F--Q--E--V--L--V--I--T--R--A--V--T--H--N--E--Q--L--C--Y--Q--L--Y--R--Q-

-P--I--P--V--K--D--L--L--L--E--D--L--Q--D--G--E--V--R--L--G--G--S--L--R--G--A--F--S--N--N-
CCAATCCCCGTGAAAGACCTCCTGCTGGAAGACCTCCAGGATGGAGAAGTGAGGCTGGGTGGCTCCCTGCGAGGGGCATTCAGCAACAAT
:: :::::::::::.:::::::::::::::::::: :::::.::::::::: :::::::.::::::::::::::::::::::::::::::
CCTATCCCCGTGAAGGACCTCCTGCTGGAAGACCTGCAGGACGGAGAAGTGCGGCTGGGCGGCTCCCTGCGAGGGGCATTCAGCAACAAT
-P--I--P--V--K--D--L--L--L--E--D--L--Q--D--G--E--V--R--L--G--G--S--L--R--G--A--F--S--N--N-

-E--R--
GAGAGAA
:::::: 
GAGAGA 
-E--R--

BGISUSX0001138545 both Identity : 100%

-K--L--H--V--F--L--F--Q--E--V--L--V--I--T--R--A--V--T--H--N--E--Q--L--C--Y--Q--L--Y--R--Q-
AAACTGCATGTTTTCCTGTTCCAAGAAGTGCTTGTGATCACTCGAGCCGTCACCCACAATGAGCAGCTTTGCTACCAGCTGTACCGTCAG
::::::::::::::::: ::::::::::::::::::::::::::::::::::::::::::::.:::::.:::::::::.::::::: :::
AAACTGCATGTTTTCCTCTTCCAAGAAGTGCTTGTGATCACTCGAGCCGTCACCCACAATGAACAGCTCTGCTACCAGTTGTACCGACAG
-K--L--H--V--F--L--F--Q--E--V--L--V--I--T--R--A--V--T--H--N--E--Q--L--C--Y--Q--L--Y--R--Q-

-P--I--P--V--K--D--L--L--L--E--D--L--Q--D--G--E--V--R--L--G--G--S--L--R--G--A--F--S--N--N-
CCAATCCCCGTGAAAGACCTCCTGCTGGAAGACCTCCAGGATGGAGAAGTGAGGCTGGGTGGCTCCCTGCGAGGGGCATTCAGCAACAAT
:: :::::::::::.:::::::::::::::::::: :::::.::::::::: :::::::.::::::::::::::::::::::::::::::
CCTATCCCCGTGAAGGACCTCCTGCTGGAAGACCTGCAGGACGGAGAAGTGCGGCTGGGCGGCTCCCTGCGAGGGGCATTCAGCAACAAT
-P--I--P--V--K--D--L--L--L--E--D--L--Q--D--G--E--V--R--L--G--G--S--L--R--G--A--F--S--N--N-

-E--R--
GAGAGAA
:::::: 
GAGAGA 
-E--R--

BGISUSX0000179898 all Identity : 100%

-K--L--H--V--F--L--F--Q--E--V--L--V--I--T--R--A--V--T--H--N--E--Q--L--C--Y--Q--L--Y--R--Q-
AAACTGCATGTTTTCCTGTTCCAAGAAGTGCTTGTGATCACTCGAGCCGTCACCCACAATGAGCAGCTTTGCTACCAGCTGTACCGTCAG
::::::::::::::::: ::::::::::::::::::::::::::::::::::::::::::::.:::::.:::::::::.::::::: :::
AAACTGCATGTTTTCCTCTTCCAAGAAGTGCTTGTGATCACTCGAGCCGTCACCCACAATGAACAGCTCTGCTACCAGTTGTACCGACAG
-K--L--H--V--F--L--F--Q--E--V--L--V--I--T--R--A--V--T--H--N--E--Q--L--C--Y--Q--L--Y--R--Q-

-P--I--P--V--K--D--L--L--L--E--D--L--Q--D--G--E--V--R--L--G--G--S--L--R--G--A--F--S--N--N-
CCAATCCCCGTGAAAGACCTCCTGCTGGAAGACCTCCAGGATGGAGAAGTGAGGCTGGGTGGCTCCCTGCGAGGGGCATTCAGCAACAAT
:: :::::::::::.:::::::::::::::::::: :::::.::::::::: :::::::.::::::::::::::::::::::::::::::
CCTATCCCCGTGAAGGACCTCCTGCTGGAAGACCTGCAGGACGGAGAAGTGCGGCTGGGCGGCTCCCTGCGAGGGGCATTCAGCAACAAT
-P--I--P--V--K--D--L--L--L--E--D--L--Q--D--G--E--V--R--L--G--G--S--L--R--G--A--F--S--N--N-

-E--R--
GAGAGAA
:::::: 
GAGAGA 
-E--R--