Exon Sequence
>ENSE00001117467 NT
ACCGGGCTTTTCACCCCGGA
CTTGGCATTCGAGGCCATTG
TGAAAAAGCAGGTCGTCAAG
CTGAAAGAGCCCTGTCTGAA
ATGTGTCGACCTGGTTATCC
AGGAGCTAATCAATACAGTT
AGGCAGTGTACCAGTAAG
>ENSE00001117467 AA
-TGLFTPDLAFEAIVKKQVV
KLKEPCLKCVDLVIQELINT
VRQCTSK

ENSE00001117467

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100