Exon Sequence
>ENSE00001117470 NT
CAACTGACCAACCACATCCG
GGAGTCGCTGCCGGCCCTAC
GTAGCAAACTACAGAGCCAG
CTGCTGTCCCTGGAGAAGGA
GGTGGAGGAGTACAAGAACT
TTCGGCCCGACGACCCCACC
CGCAAAACCAAAGCCCTGCT
G
>ENSE00001117470 AA
QLTNHIRESLPALRSKLQSQ
LLSLEKEVEEYKNFRPDDPT
RKTKALL

ENSE00001117470

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002097542 est Identity : 100%

-Q--L--T--N--H--I--R--E--S--L--P--A--L--R--S--K--L--Q--S--Q--L--L--S--L--E--K--E--V--E--E-
CAACTGACCAACCACATCCGGGAGTCGCTGCCGGCCCTACGTAGCAAACTACAGAGCCAGCTGCTGTCCCTGGAGAAGGAGGTGGAGGAG
:::::::::::.::::::::::::::::::::.:::.:.::.:::::.::.::::::::::::::::::.::::::::::::::::::::
CAACTGACCAATCACATCCGGGAGTCGCTGCCAGCCTTGCGCAGCAAGCTGCAGAGCCAGCTGCTGTCCTTGGAGAAGGAGGTGGAGGAG
-Q--L--T--N--H--I--R--E--S--L--P--A--L--R--S--K--L--Q--S--Q--L--L--S--L--E--K--E--V--E--E-

-Y--K--N--F--R--P--D--D--P--T--R--K--T--K--A--L--L---
TACAAGAACTTTCGGCCCGACGACCCCACCCGCAAAACCAAAGCCCTGCTGCA
::.::::::::.::.::.:::::.:::::.:::::.::::::::.::::::  
TATAAGAACTTCCGACCTGACGATCCCACTCGCAAGACCAAAGCTCTGCTG  
-Y--K--N--F--R--P--D--D--P--T--R--K--T--K--A--L--L---

BGISUSX0001064284 both Identity : 100%

-Q--L--T--N--H--I--R--E--S--L--P--A--L--R--S--K--L--Q--S--Q--L--L--S--L--E--K--E--V--E--E-
CAACTGACCAACCACATCCGGGAGTCGCTGCCGGCCCTACGTAGCAAACTACAGAGCCAGCTGCTGTCCCTGGAGAAGGAGGTGGAGGAG
:::::::::::.::::::::::::::::::::.:::.:.::.:::::.::.::::::::::::::::::.::::::::::::::::::::
CAACTGACCAATCACATCCGGGAGTCGCTGCCAGCCTTGCGCAGCAAGCTGCAGAGCCAGCTGCTGTCCTTGGAGAAGGAGGTGGAGGAG
-Q--L--T--N--H--I--R--E--S--L--P--A--L--R--S--K--L--Q--S--Q--L--L--S--L--E--K--E--V--E--E-

-Y--K--N--F--R--P--D--D--P--T--R--K--T--K--A--L--L---
TACAAGAACTTTCGGCCCGACGACCCCACCCGCAAAACCAAAGCCCTGCTGCA
::.::::::::.::.::.:::::.:::::.:::::.::::::::.::::::  
TATAAGAACTTCCGACCTGACGATCCCACTCGCAAGACCAAAGCTCTGCTG  
-Y--K--N--F--R--P--D--D--P--T--R--K--T--K--A--L--L---

BGISUSX0000082535 all Identity : 100%

-Q--L--T--N--H--I--R--E--S--L--P--A--L--R--S--K--L--Q--S--Q--L--L--S--L--E--K--E--V--E--E-
CAACTGACCAACCACATCCGGGAGTCGCTGCCGGCCCTACGTAGCAAACTACAGAGCCAGCTGCTGTCCCTGGAGAAGGAGGTGGAGGAG
:::::::::::.::::::::::::::::::::.:::.:.::.:::::.::.::::::::::::::::::.::::::::::::::::::::
CAACTGACCAATCACATCCGGGAGTCGCTGCCAGCCTTGCGCAGCAAGCTGCAGAGCCAGCTGCTGTCCTTGGAGAAGGAGGTGGAGGAG
-Q--L--T--N--H--I--R--E--S--L--P--A--L--R--S--K--L--Q--S--Q--L--L--S--L--E--K--E--V--E--E-

-Y--K--N--F--R--P--D--D--P--T--R--K--T--K--A--L--L---
TACAAGAACTTTCGGCCCGACGACCCCACCCGCAAAACCAAAGCCCTGCTGCA
::.::::::::.::.::.:::::.:::::.:::::.::::::::.::::::  
TATAAGAACTTCCGACCTGACGATCCCACTCGCAAGACCAAAGCTCTGCTG  
-Y--K--N--F--R--P--D--D--P--T--R--K--T--K--A--L--L---