Exon Sequence
>ENSE00001117472 NT
TACATTGGCGTGGTGAACCG
CAGCCAGAAGGATATTGAGG
GCAAGAAGGACATCCGTGCA
GCACTGGCAGCTGAGAGGAA
GTTCTTCCTCTCCCACCCGG
CCTACCGGCACATGGCCGAC
CGCATGGGCACGCCACATCT
GCAGAAGACGCTGAATCAG
>ENSE00001117472 AA
-YIGVVNRSQKDIEGKKDIR
AALAAERKFFLSHPAYRHMA
DRMGTPHLQKTLNQ

ENSE00001117472

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002097541 est Identity : 100%

-G--Y--I--G--V--V--N--R--S--Q--K--D--I--E--G--K--K--D--I--R--A--A--L--A--A--E--R--K--F--F-
-GCTACATTGGCGTGGTGAACCGCAGCCAGAAGGATATTGAGGGCAAGAAGGACATCCGTGCAGCACTGGCAGCTGAGAGGAAGTTCTTC
 ::::::::::.:::::::::::::::::::::::.::.:::::::::::::::::.:::::::: :::::.:::::::::::.::::::
GGCTACATTGGTGTGGTGAACCGCAGCCAGAAGGACATCGAGGGCAAGAAGGACATTCGTGCAGCTCTGGCGGCTGAGAGGAAATTCTTC
-G--Y--I--G--V--V--N--R--S--Q--K--D--I--E--G--K--K--D--I--R--A--A--L--A--A--E--R--K--F--F-

-L--S--H--P--A--Y--R--H--M--A--D--R--M--G--T--P--H--L--Q--K--T--L--N--Q-
CTCTCCCACCCGGCCTACCGGCACATGGCCGACCGCATGGGCACGCCACATCTGCAGAAGACGCTGAATCAG
::::::::::: :::::::::::::::::.:::::::::::::: :::::.::::::::::: :::::::::
CTCTCCCACCCCGCCTACCGGCACATGGCTGACCGCATGGGCACCCCACACCTGCAGAAGACTCTGAATCAG
-L--S--H--P--A--Y--R--H--M--A--D--R--M--G--T--P--H--L--Q--K--T--L--N--Q-

BGISUSX0001064278 both Identity : 100%

-G--Y--I--G--V--V--N--R--S--Q--K--D--I--E--G--K--K--D--I--R--A--A--L--A--A--E--R--K--F--F-
-GCTACATTGGCGTGGTGAACCGCAGCCAGAAGGATATTGAGGGCAAGAAGGACATCCGTGCAGCACTGGCAGCTGAGAGGAAGTTCTTC
 ::::::::::.:::::::::::::::::::::::.::.:::::::::::::::::.:::::::: :::::.:::::::::::.::::::
GGCTACATTGGTGTGGTGAACCGCAGCCAGAAGGACATCGAGGGCAAGAAGGACATTCGTGCAGCTCTGGCGGCTGAGAGGAAATTCTTC
-G--Y--I--G--V--V--N--R--S--Q--K--D--I--E--G--K--K--D--I--R--A--A--L--A--A--E--R--K--F--F-

-L--S--H--P--A--Y--R--H--M--A--D--R--M--G--T--P--H--L--Q--K--T--L--N--Q-
CTCTCCCACCCGGCCTACCGGCACATGGCCGACCGCATGGGCACGCCACATCTGCAGAAGACGCTGAATCAG
::::::::::: :::::::::::::::::.:::::::::::::: :::::.::::::::::: :::::::::
CTCTCCCACCCCGCCTACCGGCACATGGCTGACCGCATGGGCACCCCACACCTGCAGAAGACTCTGAATCAG
-L--S--H--P--A--Y--R--H--M--A--D--R--M--G--T--P--H--L--Q--K--T--L--N--Q-

BGISUSX0000082527 all Identity : 100%

-G--Y--I--G--V--V--N--R--S--Q--K--D--I--E--G--K--K--D--I--R--A--A--L--A--A--E--R--K--F--F-
-GCTACATTGGCGTGGTGAACCGCAGCCAGAAGGATATTGAGGGCAAGAAGGACATCCGTGCAGCACTGGCAGCTGAGAGGAAGTTCTTC
 ::::::::::.:::::::::::::::::::::::.::.:::::::::::::::::.:::::::: :::::.:::::::::::.::::::
GGCTACATTGGTGTGGTGAACCGCAGCCAGAAGGACATCGAGGGCAAGAAGGACATTCGTGCAGCTCTGGCGGCTGAGAGGAAATTCTTC
-G--Y--I--G--V--V--N--R--S--Q--K--D--I--E--G--K--K--D--I--R--A--A--L--A--A--E--R--K--F--F-

-L--S--H--P--A--Y--R--H--M--A--D--R--M--G--T--P--H--L--Q--K--T--L--N--Q-
CTCTCCCACCCGGCCTACCGGCACATGGCCGACCGCATGGGCACGCCACATCTGCAGAAGACGCTGAATCAG
::::::::::: :::::::::::::::::.:::::::::::::: :::::.::::::::::: :::::::::
CTCTCCCACCCCGCCTACCGGCACATGGCTGACCGCATGGGCACCCCACACCTGCAGAAGACTCTGAATCAG
-L--S--H--P--A--Y--R--H--M--A--D--R--M--G--T--P--H--L--Q--K--T--L--N--Q-