Exon Sequence
>ENSE00001117476 NT
CTCAGTTCCTACCCCCGGTT
GCGAGAGGAGACAGAGCGAA
TCGTCACCACTTACATCCGG
GAACGGGAGGGGAGAACGAA
GGACCAG
>ENSE00001117476 AA
LSSYPRLREETERIVTTYIR
EREGRTKDQ

ENSE00001117476

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002097548 est Identity : 100%

-L--S--S--Y--P--R--L--R--E--E--T--E--R--I--V--T--T--Y--I--R--E--R--E--G--R--T--K--D--Q-
CTCAGTTCCTACCCCCGGTTGCGAGAGGAGACAGAGCGAATCGTCACCACTTACATCCGGGAACGGGAGGGGAGAACGAAGGACCAG
:::::.::::::::::::.:::::::::::::.::.::::::::::::::::::::::::::::::::::::::::: :::::::::
CTCAGCTCCTACCCCCGGCTGCGAGAGGAGACGGAACGAATCGTCACCACTTACATCCGGGAACGGGAGGGGAGAACCAAGGACCAG
-L--S--S--Y--P--R--L--R--E--E--T--E--R--I--V--T--T--Y--I--R--E--R--E--G--R--T--K--D--Q-

BGISUSX0001064305 both Identity : 100%

-L--S--S--Y--P--R--L--R--E--E--T--E--R--I--V--T--T--Y--I--R--E--R--E--G--R--T--K--D--Q-
CTCAGTTCCTACCCCCGGTTGCGAGAGGAGACAGAGCGAATCGTCACCACTTACATCCGGGAACGGGAGGGGAGAACGAAGGACCAG
:::::.::::::::::::.:::::::::::::.::.::::::::::::::::::::::::::::::::::::::::: :::::::::
CTCAGCTCCTACCCCCGGCTGCGAGAGGAGACGGAACGAATCGTCACCACTTACATCCGGGAACGGGAGGGGAGAACCAAGGACCAG
-L--S--S--Y--P--R--L--R--E--E--T--E--R--I--V--T--T--Y--I--R--E--R--E--G--R--T--K--D--Q-

BGISUSX0000082563 all Identity : 100%

-L--S--S--Y--P--R--L--R--E--E--T--E--R--I--V--T--T--Y--I--R--E--R--E--G--R--T--K--D--Q-
CTCAGTTCCTACCCCCGGTTGCGAGAGGAGACAGAGCGAATCGTCACCACTTACATCCGGGAACGGGAGGGGAGAACGAAGGACCAG
:::::.::::::::::::.:::::::::::::.::.::::::::::::::::::::::::::::::::::::::::: :::::::::
CTCAGCTCCTACCCCCGGCTGCGAGAGGAGACGGAACGAATCGTCACCACTTACATCCGGGAACGGGAGGGGAGAACCAAGGACCAG
-L--S--S--Y--P--R--L--R--E--E--T--E--R--I--V--T--T--Y--I--R--E--R--E--G--R--T--K--D--Q-