Exon Sequence
>ENSE00001132640 NT
ATGGAGTTTGACGAGAAGGA
CTTACGACGGGAGATCAGCT
ATGCCATTAAGAACATCCAT
GGA
>ENSE00001132640 AA
MEFDEKDLRREISYAIKNIH
G

ENSE00001132640

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002097545 est Identity : 100%

-M--E--F--D--E--K--D--L--R--R--E--I--S--Y--A--I--K--N--I--H--G-
ATGGAGTTTGACGAGAAGGACTTACGACGGGAGATCAGCTATGCCATTAAGAACATCCATGGA
                              :::::::::::::::::::::::::::::::::
                              GAGATCAGCTATGCCATTAAGAACATCCATGGA
-------------------------------E--I--S--Y--A--I--K--N--I--H--G-

BGISUSX0002097545 est Identity : 100%

-M--E--F--D--E--K--D--L--R--R--E--I--S--Y--A--I--K--N--I--H--G-
ATGGAGTTTGACGAGAAGGACTTACGACGGGAGATCAGCTATGCCATTAAGAACATCCATGGA
                                                         ::::::
                                                         CATGGA
----------------------------------------------------------H--G-

BGISUSX0001064296 both Identity : 100%

-M--E--F--D--E--K--D--L--R--R--E--I--S--Y--A--I--K--N--I--H--G-
ATGGAGTTTGACGAGAAGGACTTACGACGGGAGATCAGCTATGCCATTAAGAACATCCATGGA
                              :::::::::::::::::::::::::::::::::
                              GAGATCAGCTATGCCATTAAGAACATCCATGGA
-------------------------------E--I--S--Y--A--I--K--N--I--H--G-

BGISUSX0001064296 both Identity : 100%

-M--E--F--D--E--K--D--L--R--R--E--I--S--Y--A--I--K--N--I--H--G-
ATGGAGTTTGACGAGAAGGACTTACGACGGGAGATCAGCTATGCCATTAAGAACATCCATGGA
                                                         ::::::
                                                         CATGGA
----------------------------------------------------------H--G-

BGISUSX0000082556 all Identity : 100%

-M--E--F--D--E--K--D--L--R--R--E--I--S--Y--A--I--K--N--I--H--G-
ATGGAGTTTGACGAGAAGGACTTACGACGGGAGATCAGCTATGCCATTAAGAACATCCATGGA
                              :::::::::::::::::::::::::::::::::
                              GAGATCAGCTATGCCATTAAGAACATCCATGGA
-------------------------------E--I--S--Y--A--I--K--N--I--H--G-

BGISUSX0000082556 all Identity : 100%

-M--E--F--D--E--K--D--L--R--R--E--I--S--Y--A--I--K--N--I--H--G-
ATGGAGTTTGACGAGAAGGACTTACGACGGGAGATCAGCTATGCCATTAAGAACATCCATGGA
                                                         ::::::
                                                         CATGGA
----------------------------------------------------------H--G-