Exon Sequence
>ENSE00001132917 NT
CATGCCGAGTTTTTGCACTG
CAAGTCCAAAAAGTTTACAG
ACTTTGATGAAGTCCGGCAG
GAGATTGAAGCAGAGACCGA
CAGGGTCACGGGGACCAACA
AAGGCATCTCCCCAGTGCCC
ATCAACCTTCGAGTCTACTC
GCCACAC
>ENSE00001132917 AA
-HAEFLHCKSKKFTDFDEVR
QEIEAETDRVTGTNKGISPV
PINLRVYSPH

ENSE00001132917

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0000082508 all Identity : 91.892%

----H--A--E--F--L--H--C--K--S--K--K--F--T--D--F--D--E--V--R--Q--E--I--E--A--E--T--D--R--V-
-AACATGCCGAGTTTTTGCACTGCAAGTCCAAAAAGTTTACAGACTTTGATGAAGTCCGGCAGGAGATTGAAGCAGAGACCGACAGGGTC
                                       ::::::::     :::::::.::::::::.:::::.:::::::::::::::
                                       ACAGACTTNNNNNAAGTCCGACAGGAGATCGAAGCGGAGACCGACAGGGTC
----------------------------------------T--D--X--X--X--V--R--Q--E--I--E--A--E--T--D--R--V-

-T--G--T--N--K--G--I--S--P--V--P--I--N--L--R--V--Y--S--P--H--
ACGGGGACCAACAAAGGCATCTCCCCAGTGCCCATCAACCTTCGAGTCTACTCGCCACACG
:::::::::::.:::::::::::::::::::::::::::.: ::.::::::::.:::::: 
ACGGGGACCAATAAAGGCATCTCCCCAGTGCCCATCAACTTGCGGGTCTACTCACCACAC 
-T--G--T--N--K--G--I--S--P--V--P--I--N--L--R--V--Y--S--P--H--