Exon Sequence
>ENSE00001132958 NT
ATGGGCAACCGCGGGATGGA
AGAGCTGATCCCGCTGGTCA
ACAAACTGCAGGACGCCTTC
AGCTCCATCGGCCAGAGCTG
CCACCTGGACCTGCCGCAGA
TCGCTGTAGTGGGCGGCCAG
AGCGCCGGCAAGAGCTCGGT
GCTGGAGAACTTCGTGGGC
>ENSE00001132958 AA
MGNRGMEELIPLVNKLQDAF
SSIGQSCHLDLPQIAVVGGQ
SAGKSSVLENFVG

ENSE00001132958

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003059648 reads Identity : 100%

                                                                                          
GACCGTGAGGCCGAGCCGGGAGCGGGCGTCTTGCCGAGGCCCGGGCGGGCGGGGAGCAACGGCTACAGACGCCGCGGGGCCAGGTCGTTG
                                                                                          
                                                                                          
                                                                                          

                                                       -M--G--N--R--G--M--E--E--L--I--P--L
AGGGTCGGCGGCGGGCGAGGAGCGCAGGGCGCTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGCGGGATGGAAGAGCTGATCCCGCT
                                                                                     :::::
                                                                                     CCGCT
                                                       -------------------------------P--L

--V--N--K--L--Q--D--A--F--S--S--I--G--Q--S--C--H--L--D--L--P--Q--I--A--V--V--G--G--Q--S--A
GGTCAACAAACTGCAGGACGCCTTCAGCTCCATCGGCCAGAGCTGCCACCTGGACCTGCCGCAGATCGCTGTAGTGGGCGGCCAGAGCGC
:::::::::.::::::::.:::::::::::::::::::::::::::::::::::::::::::::::.::.::.:::::::::::::::::
GGTCAACAAGCTGCAGGATGCCTTCAGCTCCATCGGCCAGAGCTGCCACCTGGACCTGCCGCAGATTGCCGTGGTGGGCGGCCAGAGCGC
--V--N--K--L--Q--D--A--F--S--S--I--G--Q--S--C--H--L--D--L--P--Q--I--A--V--V--G--G--Q--S--A

--G--K--S--S--V--L--E--N--F--V--G---
CGGCAAGAGCTCGGTGCTGGAGAACTTCGTGGGCCG
::::::::::::.::::: :::::::::::::::  
CGGCAAGAGCTCAGTGCTCGAGAACTTCGTGGGC  
--G--K--S--S--V--L--E--N--F--V--G---

BGISUSX0001064254 both Identity : 100%

                                                                                          
GACCGTGAGGCCGAGCCGGGAGCGGGCGTCTTGCCGAGGCCCGGGCGGGCGGGGAGCAACGGCTACAGACGCCGCGGGGCCAGGTCGTTG
                                                                                          
                                                                                          
                                                                                          

                                                       -M--G--N--R--G--M--E--E--L--I--P--L
AGGGTCGGCGGCGGGCGAGGAGCGCAGGGCGCTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGCGGGATGGAAGAGCTGATCCCGCT
                                                                                     :::::
                                                                                     CCGCT
                                                       -------------------------------P--L

--V--N--K--L--Q--D--A--F--S--S--I--G--Q--S--C--H--L--D--L--P--Q--I--A--V--V--G--G--Q--S--A
GGTCAACAAACTGCAGGACGCCTTCAGCTCCATCGGCCAGAGCTGCCACCTGGACCTGCCGCAGATCGCTGTAGTGGGCGGCCAGAGCGC
:::::::::.::::::::.:::::::::::::::::::::::::::::::::::::::::::::::.::.::.:::::::::::::::::
GGTCAACAAGCTGCAGGATGCCTTCAGCTCCATCGGCCAGAGCTGCCACCTGGACCTGCCGCAGATTGCCGTGGTGGGCGGCCAGAGCGC
--V--N--K--L--Q--D--A--F--S--S--I--G--Q--S--C--H--L--D--L--P--Q--I--A--V--V--G--G--Q--S--A

--G--K--S--S--V--L--E--N--F--V--G---
CGGCAAGAGCTCGGTGCTGGAGAACTTCGTGGGCCG
::::::::::::.::::: :::::::::::::::  
CGGCAAGAGCTCAGTGCTCGAGAACTTCGTGGGC  
--G--K--S--S--V--L--E--N--F--V--G---

BGISUSX0000082496 all Identity : 100%

                                                                                          
GACCGTGAGGCCGAGCCGGGAGCGGGCGTCTTGCCGAGGCCCGGGCGGGCGGGGAGCAACGGCTACAGACGCCGCGGGGCCAGGTCGTTG
                                                                                          
                                                                                          
                                                                                          

                                                       -M--G--N--R--G--M--E--E--L--I--P--L
AGGGTCGGCGGCGGGCGAGGAGCGCAGGGCGCTCGGGCCGGGGGCCGCCGGCGCCATGGGCAACCGCGGGATGGAAGAGCTGATCCCGCT
                                                                                     :::::
                                                                                     CCGCT
                                                       -------------------------------P--L

--V--N--K--L--Q--D--A--F--S--S--I--G--Q--S--C--H--L--D--L--P--Q--I--A--V--V--G--G--Q--S--A
GGTCAACAAACTGCAGGACGCCTTCAGCTCCATCGGCCAGAGCTGCCACCTGGACCTGCCGCAGATCGCTGTAGTGGGCGGCCAGAGCGC
:::::::::.::::::::.:::::::::::::::::::::::::::::::::::::::::::::::.::.::.:::::::::::::::::
GGTCAACAAGCTGCAGGATGCCTTCAGCTCCATCGGCCAGAGCTGCCACCTGGACCTGCCGCAGATTGCCGTGGTGGGCGGCCAGAGCGC
--V--N--K--L--Q--D--A--F--S--S--I--G--Q--S--C--H--L--D--L--P--Q--I--A--V--V--G--G--Q--S--A

--G--K--S--S--V--L--E--N--F--V--G---
CGGCAAGAGCTCGGTGCTGGAGAACTTCGTGGGCCG
::::::::::::.::::: :::::::::::::::  
CGGCAAGAGCTCAGTGCTCGAGAACTTCGTGGGC  
--G--K--S--S--V--L--E--N--F--V--G---