Exon Sequence
>ENSE00001254222 NT
GACTTTCCATCTTCAGTTCG
AATACATTTATTGACCAAAA
TGGCAGACATT
>ENSE00001254222 AA
-DFPSSVRIHLLTKMADI

ENSE00001254222

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003040196 reads Identity : 100%

-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---
-TTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATTGA
 :::::::::::::::::::::::::::::::::::::::::::::::::::::  
GTTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATT  
-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---

BGISUSX0003040197 reads Identity : 100%

-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---
-TTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATTGA
 :::::::::::::::::::::::::::::::::::::::::::::::::::::  
GTTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATT  
-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---

BGISUSX0002063609 est Identity : 100%

-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---
-TTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATTGA
 :::::::::::::::::::::::::::::::::::::::::::::::::::::  
GTTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATT  
-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---

BGISUSX0002063610 est Identity : 100%

-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---
-TTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATTGA
 :::::::::::::::::::::::::::::::::::::::::::::::::::::  
GTTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATT  
-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---

BGISUSX0001042287 both Identity : 100%

-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---
-TTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATTGA
 :::::::::::::::::::::::::::::::::::::::::::::::::::::  
GTTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATT  
-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---

BGISUSX0001042288 both Identity : 100%

-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---
-TTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATTGA
 :::::::::::::::::::::::::::::::::::::::::::::::::::::  
GTTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATT  
-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---

BGISUSX0000055034 all Identity : 100%

-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---
-TTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATTGA
 :::::::::::::::::::::::::::::::::::::::::::::::::::::  
GTTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATT  
-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---

BGISUSX0000055035 all Identity : 100%

-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---
-TTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATTGA
 :::::::::::::::::::::::::::::::::::::::::::::::::::::  
GTTGACTTTCCATCTTCAGTTCGAATACATTTATTGACCAAAATGGCAGACATT  
-V--D--F--P--S--S--V--R--I--H--L--L--T--K--M--A--D--I---