Exon Sequence
>ENSE00001254236 NT
GTTGATATAAGTGAAGATGG
AATGAAAGCACTAGTCACTC
TTTCCAGTGGAGACATGCGT
AGGGCTCTGAACATTTTGCA
G
>ENSE00001254236 AA
-VDISEDGMKALVTLSSGDM
RRALNILQ

ENSE00001254236

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002063603 est Identity : 96.429%

-K--V--D--I--S--E--D--G--M--K--A--L--V--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-
--AGTTGATATAAGTGAAGATGGAATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAG
  ::::::::::::.::::::::.::::::::.:: .: :: ::::::::::::::.::::: :::::.:::::.:::::::::
AAAGTTGATATAAGCGAAGATGGGATGAAAGCGCTCATAACACTTTCCAGTGGAGATATGCGAAGGGCCCTGAATATTTTGCAG
-K--V--D--I--S--E--D--G--M--K--A--L--I--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-

BGISUSX0002063602 est Identity : 95%

-K--V--D--I--S--E--D--G--M--K--A--L--V--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-
--AGTTGATATAAGTGAAGATGGAATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAG
  ::::::::::::.::::::::.::::::::.:: .: :: ::::::::::::::.:::                        
AAAGTTGATATAAGCGAAGATGGGATGAAAGCGCTCATAACACTTTCCAGTGGAGATATG                        
-K--V--D--I--S--E--D--G--M--K--A--L--I--T--L--S--S--G--D--M-------------------------

BGISUSX0003040193 reads Identity : 92.857%

-K--V--D--I--S--E--D--G--M--K--A--L--V--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-
--AGTTGATATAAGTGAAGATGGAATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAG
  ::::::::::::.::::::::.::::::::.:: .: :: ::::::::::::::.::::: :::::.:::::.:::::::::
AGAGTTGATATAAGCGAAGATGGGATGAAAGCGCTCATAACACTTTCCAGTGGAGATATGCGAAGGGCCCTGAATATTTTGCAG
-R--V--D--I--S--E--D--G--M--K--A--L--I--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-

BGISUSX0001042273 both Identity : 92.857%

-K--V--D--I--S--E--D--G--M--K--A--L--V--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-
--AGTTGATATAAGTGAAGATGGAATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAG
  ::::::::::::.::::::::.::::::::.:: .: :: ::::::::::::::.::::: :::::.:::::.:::::::::
AGAGTTGATATAAGCGAAGATGGGATGAAAGCGCTCATAACACTTTCCAGTGGAGATATGCGAAGGGCCCTGAATATTTTGCAG
-R--V--D--I--S--E--D--G--M--K--A--L--I--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-

BGISUSX0000055017 all Identity : 92.857%

-K--V--D--I--S--E--D--G--M--K--A--L--V--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-
--AGTTGATATAAGTGAAGATGGAATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAG
  ::::::::::::.::::::::.::::::::.:: .: :: ::::::::::::::.::::: :::::.:::::.:::::::::
AGAGTTGATATAAGCGAAGATGGGATGAAAGCGCTCATAACACTTTCCAGTGGAGATATGCGAAGGGCCCTGAATATTTTGCAG
-R--V--D--I--S--E--D--G--M--K--A--L--I--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-

BGISUSX0003040193 reads Identity : 62.5%

----V--D--I--S--E--D--G--M--K--A--L--V--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-
--AGTTGATATAAGTGAAGATGGAATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAG
                           ::::...::   .: :::::   .                                 
                           AAAGTGTTATGAGCGCTTTCATCC                                 
----------------------------K--V--L--*--A--L--S--S----------------------------------

BGISUSX0002063602 est Identity : 62.5%

----V--D--I--S--E--D--G--M--K--A--L--V--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-
--AGTTGATATAAGTGAAGATGGAATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAG
                           ::::...::   .: :::::   .                                 
                           AAAGTGTTATGAGCGCTTTCATCC                                 
----------------------------K--V--L--*--A--L--S--S----------------------------------

BGISUSX0002063603 est Identity : 62.5%

----V--D--I--S--E--D--G--M--K--A--L--V--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-
--AGTTGATATAAGTGAAGATGGAATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAG
                           ::::...::   .: :::::   .                                 
                           AAAGTGTTATGAGCGCTTTCATCC                                 
----------------------------K--V--L--*--A--L--S--S----------------------------------

BGISUSX0001042273 both Identity : 62.5%

----V--D--I--S--E--D--G--M--K--A--L--V--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-
--AGTTGATATAAGTGAAGATGGAATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAG
                           ::::...::   .: :::::   .                                 
                           AAAGTGTTATGAGCGCTTTCATCC                                 
----------------------------K--V--L--*--A--L--S--S----------------------------------

BGISUSX0000055017 all Identity : 62.5%

----V--D--I--S--E--D--G--M--K--A--L--V--T--L--S--S--G--D--M--R--R--A--L--N--I--L--Q-
--AGTTGATATAAGTGAAGATGGAATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAG
                           ::::...::   .: :::::   .                                 
                           AAAGTGTTATGAGCGCTTTCATCC                                 
----------------------------K--V--L--*--A--L--S--S----------------------------------