Exon Sequence
>ENSE00001254246 NT
ATTGAGAAATTCACAGAAAA
TACCAGATTCTGCCTCATCT
GTAACTATCTGTCAAAGATC
ATCCCTGCCTTGCAGTCCCG
CTGCACGAGGTTTCGGTTCG
GTCCCCTGACTCCTGAACTC
ATGGTTCCCCGCCTGGAACA
TGTCGTGGAAGAAGAG
>ENSE00001254246 AA
-IEKFTENTRFCLICNYLSK
IIPALQSRCTRFRFGPLTPE
LMVPRLEHVVEEE

ENSE00001254246

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003040191 reads Identity : 100%

-V--I--E--K--F--T--E--N--T--R--F--C--L--I--C--N--Y--L--S--K--I--I--P--A--L--Q--S--R--C--T-
-TAATTGAGAAATTCACAGAAAATACCAGATTCTGCCTCATCTGTAACTATCTGTCAAAGATCATCCCTGCCTTGCAGTCCCGCTGCACG
 :.:::::.:::::.:: ::::::::::::::.:::::::::::.::::::::::::::::::::.::.::::::::::: :: ::.::.
GTGATTGAAAAATTTACTGAAAATACCAGATTTTGCCTCATCTGCAACTATCTGTCAAAGATCATTCCCGCCTTGCAGTCGCGGTGTACA
-V--I--E--K--F--T--E--N--T--R--F--C--L--I--C--N--Y--L--S--K--I--I--P--A--L--Q--S--R--C--T-

-R--F--R--F--G--P--L--T--P--E--L--M--V--P--R--L--E--H--V--V--E--E--E---
AGGTTTCGGTTCGGTCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTCGTGGAAGAAGAGAA
:::::.::.:::::.:::::::::::::::::::::::::::::::::::::::::.::.:::::::::  
AGGTTCCGATTCGGCCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTTGTAGAAGAAGAG  
-R--F--R--F--G--P--L--T--P--E--L--M--V--P--R--L--E--H--V--V--E--E--E---

BGISUSX0002063600 est Identity : 100%

-V--I--E--K--F--T--E--N--T--R--F--C--L--I--C--N--Y--L--S--K--I--I--P--A--L--Q--S--R--C--T-
-TAATTGAGAAATTCACAGAAAATACCAGATTCTGCCTCATCTGTAACTATCTGTCAAAGATCATCCCTGCCTTGCAGTCCCGCTGCACG
 :.:::::.:::::.:: ::::::::::::::.:::::::::::.::::::::::::::::::::.::.::::::::::: :: ::.::.
GTGATTGAAAAATTTACTGAAAATACCAGATTTTGCCTCATCTGCAACTATCTGTCAAAGATCATTCCCGCCTTGCAGTCGCGGTGTACA
-V--I--E--K--F--T--E--N--T--R--F--C--L--I--C--N--Y--L--S--K--I--I--P--A--L--Q--S--R--C--T-

-R--F--R--F--G--P--L--T--P--E--L--M--V--P--R--L--E--H--V--V--E--E--E---
AGGTTTCGGTTCGGTCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTCGTGGAAGAAGAGAA
:::::.::.:::::.:::::::::::::::::::::::::::::::::::::::::.::.:::::::::  
AGGTTCCGATTCGGCCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTTGTAGAAGAAGAG  
-R--F--R--F--G--P--L--T--P--E--L--M--V--P--R--L--E--H--V--V--E--E--E---

BGISUSX0001042267 both Identity : 100%

-V--I--E--K--F--T--E--N--T--R--F--C--L--I--C--N--Y--L--S--K--I--I--P--A--L--Q--S--R--C--T-
-TAATTGAGAAATTCACAGAAAATACCAGATTCTGCCTCATCTGTAACTATCTGTCAAAGATCATCCCTGCCTTGCAGTCCCGCTGCACG
 :.:::::.:::::.:: ::::::::::::::.:::::::::::.::::::::::::::::::::.::.::::::::::: :: ::.::.
GTGATTGAAAAATTTACTGAAAATACCAGATTTTGCCTCATCTGCAACTATCTGTCAAAGATCATTCCCGCCTTGCAGTCGCGGTGTACA
-V--I--E--K--F--T--E--N--T--R--F--C--L--I--C--N--Y--L--S--K--I--I--P--A--L--Q--S--R--C--T-

-R--F--R--F--G--P--L--T--P--E--L--M--V--P--R--L--E--H--V--V--E--E--E---
AGGTTTCGGTTCGGTCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTCGTGGAAGAAGAGAA
:::::.::.:::::.:::::::::::::::::::::::::::::::::::::::::.::.:::::::::  
AGGTTCCGATTCGGCCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTTGTAGAAGAAGAG  
-R--F--R--F--G--P--L--T--P--E--L--M--V--P--R--L--E--H--V--V--E--E--E---

BGISUSX0000055009 all Identity : 100%

-V--I--E--K--F--T--E--N--T--R--F--C--L--I--C--N--Y--L--S--K--I--I--P--A--L--Q--S--R--C--T-
-TAATTGAGAAATTCACAGAAAATACCAGATTCTGCCTCATCTGTAACTATCTGTCAAAGATCATCCCTGCCTTGCAGTCCCGCTGCACG
 :.:::::.:::::.:: ::::::::::::::.:::::::::::.::::::::::::::::::::.::.:::::::::::::: ::.::.
GTGATTGAAAAATTTACTGAAAATACCAGATTTTGCCTCATCTGCAACTATCTGTCAAAGATCATTCCCGCCTTGCAGTCCCGGTGTACA
-V--I--E--K--F--T--E--N--T--R--F--C--L--I--C--N--Y--L--S--K--I--I--P--A--L--Q--S--R--C--T-

-R--F--R--F--G--P--L--T--P--E--L--M--V--P--R--L--E--H--V--V--E--E--E---
AGGTTTCGGTTCGGTCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTCGTGGAAGAAGAGAA
:::::.::.:::::.:::::::::::::::::::::::::::::::::::::::::.::.:::::::::  
AGGTTCCGATTCGGCCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTTGTAGAAGAAGAG  
-R--F--R--F--G--P--L--T--P--E--L--M--V--P--R--L--E--H--V--V--E--E--E---

BGISUSX0002063601 est Identity : 96%

-V--I--E--K--F--T--E--N--T--R--F--C--L--I--C--N--Y--L--S--K--I--I--P--A--L--Q--S--R--C--T-
-TAATTGAGAAATTCACAGAAAATACCAGATTCTGCCTCATCTGTAACTATCTGTCAAAGATCATCCCTGCCTTGCAGTCCCGCTGCACG
 :.:::::.:::::.:: ::::::::::::::. ::::::::::.::::::::::::::::::::.::.::::::               
GTGATTGAAAAATTTACTGAAAATACCAGATTTAGCCTCATCTGCAACTATCTGTCAAAGATCATTCCCGCCTTG               
-V--I--E--K--F--T--E--N--T--R--F--S--L--I--C--N--Y--L--S--K--I--I--P--A--L----------------

-R--F--R--F--G--P--L--T--P--E--L--M--V--P--R--L--E--H--V--V--E--E--E---
AGGTTTCGGTTCGGTCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTCGTGGAAGAAGAGAA
                                                                       
                                                                       
-----------------------------------------------------------------------

BGISUSX0001042268 both Identity : 96%

-V--I--E--K--F--T--E--N--T--R--F--C--L--I--C--N--Y--L--S--K--I--I--P--A--L--Q--S--R--C--T-
-TAATTGAGAAATTCACAGAAAATACCAGATTCTGCCTCATCTGTAACTATCTGTCAAAGATCATCCCTGCCTTGCAGTCCCGCTGCACG
 :.:::::.:::::.:: ::::::::::::::. ::::::::::.::::::::::::::::::::.::.::::::               
GTGATTGAAAAATTTACTGAAAATACCAGATTTAGCCTCATCTGCAACTATCTGTCAAAGATCATTCCCGCCTTG               
-V--I--E--K--F--T--E--N--T--R--F--S--L--I--C--N--Y--L--S--K--I--I--P--A--L----------------

-R--F--R--F--G--P--L--T--P--E--L--M--V--P--R--L--E--H--V--V--E--E--E---
AGGTTTCGGTTCGGTCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTCGTGGAAGAAGAGAA
                                                                       
                                                                       
-----------------------------------------------------------------------

BGISUSX0000055010 all Identity : 96%

-V--I--E--K--F--T--E--N--T--R--F--C--L--I--C--N--Y--L--S--K--I--I--P--A--L--Q--S--R--C--T-
-TAATTGAGAAATTCACAGAAAATACCAGATTCTGCCTCATCTGTAACTATCTGTCAAAGATCATCCCTGCCTTGCAGTCCCGCTGCACG
 :.:::::.:::::.:: ::::::::::::::. ::::::::::.::::::::::::::::::::.::.::::::               
GTGATTGAAAAATTTACTGAAAATACCAGATTTAGCCTCATCTGCAACTATCTGTCAAAGATCATTCCCGCCTTG               
-V--I--E--K--F--T--E--N--T--R--F--S--L--I--C--N--Y--L--S--K--I--I--P--A--L----------------

-R--F--R--F--G--P--L--T--P--E--L--M--V--P--R--L--E--H--V--V--E--E--E---
AGGTTTCGGTTCGGTCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTCGTGGAAGAAGAGAA
                                                                       
                                                                       
-----------------------------------------------------------------------

BGISUSX0000055009 all Identity : 66.667%

----I--E--K--F--T--E--N--T--R--F--C--L--I--C--N--Y--L--S--K--I--I--P--A--L--Q--S--R--C--T-
-TAATTGAGAAATTCACAGAAAATACCAGATTCTGCCTCATCTGTAACTATCTGTCAAAGATCATCCCTGCCTTGCAGTCCCGCTGCACG
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-R--F--R--F--G--P--L--T--P--E--L--M--V--P--R--L--E--H--V--V--E--E--E---
AGGTTTCGGTTCGGTCCCCTGACTCCTGAACTCATGGTTCCCCGCCTGGAACATGTCGTGGAAGAAGAGAA
               ::..  :: :: :.:::                                       
               CCTTGTACACCGGGACTG                                      
----------------P--C--T--P--G--L---------------------------------------