Exon Sequence
>ENSE00001254253 NT
AAAGGCTTTAAGCTAGTGAT
CTTGGATGAAGCAGACGCCA
TGACTCAGGACGCCCAGAAT
GCCTTGAGAAGA
>ENSE00001254253 AA
-KGFKLVILDEADAMTQDAQ
NALRR

ENSE00001254253

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002063595 est Identity : 100%

-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q-----N--A--L--R--R--
--GAAAGGCTTTAAGCTAGTGATCTTGGATGAAGCAGACGCCATGACTCAGGACGCCCAG---AATGCCTTGAGAAGAG
  :::.::::::::.:::::::::::::::::::: ::.::::::::::::::.::::::   ::.:::::: :.::: 
AAGAAGGGCTTTAAACTAGTGATCTTGGATGAAGCTGATGCCATGACTCAGGATGCCCAGA--AACGCCTTGCGGAGA 
-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q--\--N--A--L--R--R--

BGISUSX0002063596 est Identity : 100%

-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q--N--A--L--R--R--
--GAAAGGCTTTAAGCTAGTGATCTTGGATGAAGCAGACGCCATGACTCAGGACGCCCAGAATGCCTTGAGAAGAG
  :::.::::::::.:::::::::::::::::::: ::.::::::::::::::.::::::::.:::::: :.::: 
AAGAAGGGCTTTAAACTAGTGATCTTGGATGAAGCTGATGCCATGACTCAGGATGCCCAGAACGCCTTGCGGAGA 
-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q--N--A--L--R--R--

BGISUSX0001042257 both Identity : 100%

-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q-----N--A--L--R--R--
--GAAAGGCTTTAAGCTAGTGATCTTGGATGAAGCAGACGCCATGACTCAGGACGCCCAG---AATGCCTTGAGAAGAG
  :::.::::::::.:::::::::::::::::::: ::.::::::::::::::.::::::   ::.:::::: :.::: 
AAGAAGGGCTTTAAACTAGTGATCTTGGATGAAGCTGATGCCATGACTCAGGATGCCCAGA--AACGCCTTGCGGAGA 
-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q--\--N--A--L--R--R--

BGISUSX0001042258 both Identity : 100%

-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q--N--A--L--R--R--
--GAAAGGCTTTAAGCTAGTGATCTTGGATGAAGCAGACGCCATGACTCAGGACGCCCAGAATGCCTTGAGAAGAG
  :::.::::::::.:::::::::::::::::::: ::.::::::::::::::.::::::::.:::::: :.::: 
AAGAAGGGCTTTAAACTAGTGATCTTGGATGAAGCTGATGCCATGACTCAGGATGCCCAGAACGCCTTGCGGAGA 
-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q--N--A--L--R--R--

BGISUSX0000055001 all Identity : 100%

-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q-----N--A--L--R--R--
--GAAAGGCTTTAAGCTAGTGATCTTGGATGAAGCAGACGCCATGACTCAGGACGCCCAG---AATGCCTTGAGAAGAG
  :::.::::::::.:::::::::::::::::::: ::.::::::::::::::.::::::   ::.:::::: :.::: 
AAGAAGGGCTTTAAACTAGTGATCTTGGATGAAGCTGATGCCATGACTCAGGATGCCCAGA--AACGCCTTGCGGAGA 
-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q--\--N--A--L--R--R--

BGISUSX0000055002 all Identity : 100%

-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q--N--A--L--R--R--
--GAAAGGCTTTAAGCTAGTGATCTTGGATGAAGCAGACGCCATGACTCAGGACGCCCAGAATGCCTTGAGAAGAG
  :::.::::::::.:::::::::::::::::::: ::.::::::::::::::.::::::::.:::::: :.::: 
AAGAAGGGCTTTAAACTAGTGATCTTGGATGAAGCTGATGCCATGACTCAGGATGCCCAGAACGCCTTGCGGAGA 
-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q--N--A--L--R--R--

BGISUSX0000055003 all Identity : 100%

-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q--N--A--L--R--R--
--GAAAGGCTTTAAGCTAGTGATCTTGGATGAAGCAGACGCCATGACTCAGGACGCCCAGAATGCCTTGAGAAGAG
  :::.::::::::.:::::::::::::::::::: ::.::::::::::::::.::::::::.:::::: :.::: 
AAGAAGGGCTTTAAACTAGTGATCTTGGATGAAGCTGATGCCATGACTCAGGATGCCCAGAACGCCTTGCGGAGA 
-K--K--G--F--K--L--V--I--L--D--E--A--D--A--M--T--Q--D--A--Q--N--A--L--R--R--