Exon Sequence
>ENSE00001254261 NT
CTGAATGCTTCAGATGACCG
AGGAATAGACATCATTCGAG
GACCGATCCTGAGCTTTGCT
AGCACAAGGACAATATTT
>ENSE00001254261 AA
LNASDDRGIDIIRGPILSFA
STRTIF

ENSE00001254261

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002063593 est Identity : 96.154%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
:::::::::::::::::::::::::::::.:::.::::.:::::.:::::::::::::::::::::::::::::::::  
CTGAATGCTTCAGATGACCGAGGAATAGATATCGTTCGGGGACCAATCCTGAGCTTTGCTAGCACAAGGACAATATTT  
-L--N--A--S--D--D--R--G--I--D--I--V--R--G--P--I--L--S--F--A--S--T--R--T--I--F---

BGISUSX0002063594 est Identity : 96.154%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
:::::::::::::::::::::::::::::.:::.::::.:::::.:::::::::::::::::::::::::::::::::  
CTGAATGCTTCAGATGACCGAGGAATAGATATCGTTCGGGGACCAATCCTGAGCTTTGCTAGCACAAGGACAATATTT  
-L--N--A--S--D--D--R--G--I--D--I--V--R--G--P--I--L--S--F--A--S--T--R--T--I--F---

BGISUSX0001042251 both Identity : 96.154%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
:::::::::::::::::::::::::::::.:::.::::.:::::.:::::::::::::::::::::::::::::::::  
CTGAATGCTTCAGATGACCGAGGAATAGATATCGTTCGGGGACCAATCCTGAGCTTTGCTAGCACAAGGACAATATTT  
-L--N--A--S--D--D--R--G--I--D--I--V--R--G--P--I--L--S--F--A--S--T--R--T--I--F---

BGISUSX0001042252 both Identity : 96.154%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
:::::::::::::::::::::::::::::.:::.::::.:::::.:::::::::::::::::::::::::::::::::  
CTGAATGCTTCAGATGACCGAGGAATAGATATCGTTCGGGGACCAATCCTGAGCTTTGCTAGCACAAGGACAATATTT  
-L--N--A--S--D--D--R--G--I--D--I--V--R--G--P--I--L--S--F--A--S--T--R--T--I--F---

BGISUSX0000054994 all Identity : 96.154%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
:::::::::::::::::::::::::::::.:::.::::.:::::.:::::::::::::::::::::::::::::::::  
CTGAATGCTTCAGATGACCGAGGAATAGATATCGTTCGGGGACCAATCCTGAGCTTTGCTAGCACAAGGACAATATTT  
-L--N--A--S--D--D--R--G--I--D--I--V--R--G--P--I--L--S--F--A--S--T--R--T--I--F---

BGISUSX0000054995 all Identity : 96.154%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
:::::::::::::::::::::::::::::.:::.::::.:::::.:::::::::::::::::::::::::::::::::  
CTGAATGCTTCAGATGACCGAGGAATAGATATCGTTCGGGGACCAATCCTGAGCTTTGCTAGCACAAGGACAATATTT  
-L--N--A--S--D--D--R--G--I--D--I--V--R--G--P--I--L--S--F--A--S--T--R--T--I--F---

BGISUSX0000054993 all Identity : 92.308%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
:::::::::::::::::::::::::::::.:::.::::.:::::.:::::::::::::::::::::::::::.:::::  
CTGAATGCTTCAGATGACCGAGGAATAGATATCGTTCGGGGACCAATCCTGAGCTTTGCTAGCACAAGGACAGTATTT  
-L--N--A--S--D--D--R--G--I--D--I--V--R--G--P--I--L--S--F--A--S--T--R--T--V--F---

BGISUSX0000054997 all Identity : 92.308%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
:::::::::::::::::::::::::::::.:::.::: .:::::.:::::::::::::::::::::::::::::::::  
CTGAATGCTTCAGATGACCGAGGAATAGATATCGTTCTGGGACCAATCCTGAGCTTTGCTAGCACAAGGACAATATTT  
-L--N--A--S--D--D--R--G--I--D--I--V--L--G--P--I--L--S--F--A--S--T--R--T--I--F---

BGISUSX0000054998 all Identity : 92.308%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
:::::::::::  ::::::::::::::::.:::.::::.:::::.:::::::::::::::::::::::::::::::::  
CTGAATGCTTCCTATGACCGAGGAATAGATATCGTTCGGGGACCAATCCTGAGCTTTGCTAGCACAAGGACAATATTT  
-L--N--A--S--Y--D--R--G--I--D--I--V--R--G--P--I--L--S--F--A--S--T--R--T--I--F---

BGISUSX0002063592 est Identity : 84.211%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                     ::::: :.::. :  ::.:::::.:::::::::::::::::::::::::::::::::  
                     GGAATCGGCACGAGGCGGGGACCAATCCTGAGCTTTGCTAGCACAAGGACAATATTT  
----------------------G--I--G--T--R--R--G--P--I--L--S--F--A--S--T--R--T--I--F---

BGISUSX0001042250 both Identity : 84.211%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                     ::::: :.::. :  ::.:::::.:::::::::::::::::::::::::::::::::  
                     GGAATCGGCACGAGGCGGGGACCAATCCTGAGCTTTGCTAGCACAAGGACAATATTT  
----------------------G--I--G--T--R--R--G--P--I--L--S--F--A--S--T--R--T--I--F---

BGISUSX0000054996 all Identity : 84.211%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                     ::::: :.::. :  ::.:::::.:::::::::::::::::::::::::::::::::  
                     GGAATCGGCACGAGGCGGGGACCAATCCTGAGCTTTGCTAGCACAAGGACAATATTT  
----------------------G--I--G--T--R--R--G--P--I--L--S--F--A--S--T--R--T--I--F---

BGISUSX0002063592 est Identity : 75%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                                       :: ::   :::                              
                                       GGTCCCCGCCTC                             
----------------------------------------G--P--R--L------------------------------

BGISUSX0001042250 both Identity : 75%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                                       :: ::   :::                              
                                       GGTCCCCGCCTC                             
----------------------------------------G--P--R--L------------------------------

BGISUSX0000054996 all Identity : 75%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                                       :: ::   :::                              
                                       GGTCCCCGCCTC                             
----------------------------------------G--P--R--L------------------------------

BGISUSX0002063593 est Identity : 57.143%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                  :::. .:::  .::. .:::.                                         
                  CGAACGATATCTATTCCTCGG                                         
-------------------R--T--I--S--I--P--R------------------------------------------

BGISUSX0002063594 est Identity : 57.143%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                  :::. .:::  .::. .:::.                                         
                  CGAACGATATCTATTCCTCGG                                         
-------------------R--T--I--S--I--P--R------------------------------------------

BGISUSX0001042251 both Identity : 57.143%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                  :::. .:::  .::. .:::.                                         
                  CGAACGATATCTATTCCTCGG                                         
-------------------R--T--I--S--I--P--R------------------------------------------

BGISUSX0001042252 both Identity : 57.143%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                  :::. .:::  .::. .:::.                                         
                  CGAACGATATCTATTCCTCGG                                         
-------------------R--T--I--S--I--P--R------------------------------------------

BGISUSX0000054993 all Identity : 57.143%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                  :::. .:::  .::. .:::.                                         
                  CGAACGATATCTATTCCTCGG                                         
-------------------R--T--I--S--I--P--R------------------------------------------

BGISUSX0000054994 all Identity : 57.143%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                  :::. .:::  .::. .:::.                                         
                  CGAACGATATCTATTCCTCGG                                         
-------------------R--T--I--S--I--P--R------------------------------------------

BGISUSX0000054995 all Identity : 57.143%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                  :::. .:::  .::. .:::.                                         
                  CGAACGATATCTATTCCTCGG                                         
-------------------R--T--I--S--I--P--R------------------------------------------

BGISUSX0000054997 all Identity : 57.143%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                   ::. .:::  .::. .:::.                                         
                  AGAACGATATCTATTCCTCGG                                         
-------------------R--T--I--S--I--P--R------------------------------------------

BGISUSX0000054998 all Identity : 57.143%

-L--N--A--S--D--D--R--G--I--D--I--I--R--G--P--I--L--S--F--A--S--T--R--T--I--F---
CTGAATGCTTCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAA
                  :::. .:::  .::. .:::.                                         
                  CGAACGATATCTATTCCTCGG                                         
-------------------R--T--I--S--I--P--R------------------------------------------