Exon Sequence
>ENSE00001254299 NT
TACAGGCTTTCTGTTGGCAC
CAACGAGAAGATCCAGCTGA
GCTCCCTCATTGCTGCATTT
CAAGTCACCAGAGACCTGAT
TGTTGCAGAGGCCTAG
>ENSE00001254299 AA
-YRLSVGTNEKIQLSSLIAA
FQVTRDLIVAEA*

ENSE00001254299

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100