Exon Sequence
>ENSE00001293835 NT
GGCCCCTATCAGATTGAGGT
CCACATCGTGGCCACCGGCA
CACTCCCCAACGGCACCCTC
TACGCAGCCAGGGGCTCCCA
GGTGGACTTCAGCTGCAACA
GCAGCTCCAGGCCACCACCC
GTGGTTGAATGGTGGTTCCA
GGCCCTGAATTCCAGCAGCG
AGTCCTTTGGCCACAACCTG
ACAGTCAACTTTTTCTCACT
GTTACTGATATCGCCAAACC
TCCAAGGGAACTACACCTGT
TTAGCCTTGAATCAGCTCAG
CAAGAGACATCGAAAGGTGA
CCACCGAGCTCCTGGTCTAC
>ENSE00001293835 AA
-GPYQIEVHIVATGTLPNGT
LYAARGSQVDFSCNSSSRPP
PVVEWWFQALNSSSESFGHN
LTVNFFSLLLISPNLQGNYT
CLALNQLSKRHRKVTTELLV
Y

ENSE00001293835

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100