Exon Sequence
>ENSE00001298391 NT
GGTGTACACATGATGGTGGC
CACCCCGGGGCGCCTCATGG
ATTTGCTGCAGAAGAAGATG
GTCAGCCTAGACATCTGTCG
CTACCTGGCCCTGGACGAGG
CTGACCGCATGATCGACATG
GGCTTCGAGGGTGACATCCG
TACCATCTTCTCCTACTTCA
AG
>ENSE00001298391 AA
-GVHMMVATPGRLMDLLQKK
MVSLDICRYLALDEADRMID
MGFEGDIRTIFSYFK

ENSE00001298391

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002030878 est Identity : 100%

-H--G--V--H--M--M--V--A--T--P--G--R--L--M--D--L--L--Q--K--K--M--V--S--L--D--I--C--R--Y--L-
--CGGTGTACACATGATGGTGGCCACCCCGGGGCGCCTCATGGATTTGCTGCAGAAGAAGATGGTCAGCCTAGACATCTGTCGCTACCTG
  .::.::.::::::::::::::::: :: :::::::::::::::.:::::::::::::::::::::::::.::::::::.::.::::::
CATGGCGTGCACATGATGGTGGCCACACCTGGGCGCCTCATGGATCTGCTGCAGAAGAAGATGGTCAGCCTGGACATCTGCCGTTACCTG
-H--G--V--H--M--M--V--A--T--P--G--R--L--M--D--L--L--Q--K--K--M--V--S--L--D--I--C--R--Y--L-

-A--L--D--E--A--D--R--M--I--D--M--G--F--E--G--D--I--R--T--I--F--S--Y--F--K-
GCCCTGGACGAGGCTGACCGCATGATCGACATGGGCTTCGAGGGTGACATCCGTACCATCTTCTCCTACTTCAAG
::::::::.::::::::::::::::::::::::::.::.:::::.::::::::::::::::::::::::::::::
GCCCTGGATGAGGCTGACCGCATGATCGACATGGGTTTTGAGGGCGACATCCGTACCATCTTCTCCTACTTCAAG
-A--L--D--E--A--D--R--M--I--D--M--G--F--E--G--D--I--R--T--I--F--S--Y--F--K-

BGISUSX0001020560 both Identity : 100%

-H--G--V--H--M--M--V--A--T--P--G--R--L--M--D--L--L--Q--K--K--M--V--S--L--D--I--C--R--Y--L-
--CGGTGTACACATGATGGTGGCCACCCCGGGGCGCCTCATGGATTTGCTGCAGAAGAAGATGGTCAGCCTAGACATCTGTCGCTACCTG
  .::.::.::::::::::::::::: :: :::::::::::::::.:::::::::::::::::::::::::.::::::::.::.::::::
CATGGCGTGCACATGATGGTGGCCACACCTGGGCGCCTCATGGATCTGCTGCAGAAGAAGATGGTCAGCCTGGACATCTGCCGTTACCTG
-H--G--V--H--M--M--V--A--T--P--G--R--L--M--D--L--L--Q--K--K--M--V--S--L--D--I--C--R--Y--L-

-A--L--D--E--A--D--R--M--I--D--M--G--F--E--G--D--I--R--T--I--F--S--Y--F--K-
GCCCTGGACGAGGCTGACCGCATGATCGACATGGGCTTCGAGGGTGACATCCGTACCATCTTCTCCTACTTCAAG
::::::::.::::::::::::::::::::::::::.::.:::::.::::::::::::::::::::::::::::::
GCCCTGGATGAGGCTGACCGCATGATCGACATGGGTTTTGAGGGCGACATCCGTACCATCTTCTCCTACTTCAAG
-A--L--D--E--A--D--R--M--I--D--M--G--F--E--G--D--I--R--T--I--F--S--Y--F--K-

BGISUSX0000027039 all Identity : 100%

-H--G--V--H--M--M--V--A--T--P--G--R--L--M--D--L--L--Q--K--K--M--V--S--L--D--I--C--R--Y--L-
--CGGTGTACACATGATGGTGGCCACCCCGGGGCGCCTCATGGATTTGCTGCAGAAGAAGATGGTCAGCCTAGACATCTGTCGCTACCTG
  .::.::.::::::::::::::::: :: :::::::::::::::.:::::::::::::::::::::::::.::::::::.::.::::::
CATGGCGTGCACATGATGGTGGCCACACCTGGGCGCCTCATGGATCTGCTGCAGAAGAAGATGGTCAGCCTGGACATCTGCCGTTACCTG
-H--G--V--H--M--M--V--A--T--P--G--R--L--M--D--L--L--Q--K--K--M--V--S--L--D--I--C--R--Y--L-

-A--L--D--E--A--D--R--M--I--D--M--G--F--E--G--D--I--R--T--I--F--S--Y--F--K-
GCCCTGGACGAGGCTGACCGCATGATCGACATGGGCTTCGAGGGTGACATCCGTACCATCTTCTCCTACTTCAAG
::::::::.::::::::::::::::::::::::::.::.:::::.::::::::::::::::::::::::::::::
GCCCTGGATGAGGCTGACCGCATGATCGACATGGGTTTTGAGGGCGACATCCGTACCATCTTCTCCTACTTCAAG
-A--L--D--E--A--D--R--M--I--D--M--G--F--E--G--D--I--R--T--I--F--S--Y--F--K-

BGISUSX0002030878 est Identity : 66.667%

-H--G--V--H--M--M--V--A--T--P--G--R--L--M--D--L--L--Q--K--K--M--V--S--L--D--I--C--R--Y--L-
--CGGTGTACACATGATGGTGGCCACCCCGGGGCGCCTCATGGATTTGCTGCAGAAGAAGATGGTCAGCCTAGACATCTGTCGCTACCTG
  . .:::.:::.. :::                                                                        
CATCATGTGCACGCCATG                                                                        
-H--H--V--H--A--M-------------------------------------------------------------------------

-A--L--D--E--A--D--R--M--I--D--M--G--F--E--G--D--I--R--T--I--F--S--Y--F--K-
GCCCTGGACGAGGCTGACCGCATGATCGACATGGGCTTCGAGGGTGACATCCGTACCATCTTCTCCTACTTCAAG
                                                                           
                                                                           
---------------------------------------------------------------------------

BGISUSX0001020560 both Identity : 66.667%

-H--G--V--H--M--M--V--A--T--P--G--R--L--M--D--L--L--Q--K--K--M--V--S--L--D--I--C--R--Y--L-
--CGGTGTACACATGATGGTGGCCACCCCGGGGCGCCTCATGGATTTGCTGCAGAAGAAGATGGTCAGCCTAGACATCTGTCGCTACCTG
  . .:::.:::.. :::                                                                        
CATCATGTGCACGCCATG                                                                        
-H--H--V--H--A--M-------------------------------------------------------------------------

-A--L--D--E--A--D--R--M--I--D--M--G--F--E--G--D--I--R--T--I--F--S--Y--F--K-
GCCCTGGACGAGGCTGACCGCATGATCGACATGGGCTTCGAGGGTGACATCCGTACCATCTTCTCCTACTTCAAG
                                                                           
                                                                           
---------------------------------------------------------------------------

BGISUSX0000027039 all Identity : 66.667%

-H--G--V--H--M--M--V--A--T--P--G--R--L--M--D--L--L--Q--K--K--M--V--S--L--D--I--C--R--Y--L-
--CGGTGTACACATGATGGTGGCCACCCCGGGGCGCCTCATGGATTTGCTGCAGAAGAAGATGGTCAGCCTAGACATCTGTCGCTACCTG
  . .:::.:::.. :::                                                                        
CATCATGTGCACGCCATG                                                                        
-H--H--V--H--A--M-------------------------------------------------------------------------

-A--L--D--E--A--D--R--M--I--D--M--G--F--E--G--D--I--R--T--I--F--S--Y--F--K-
GCCCTGGACGAGGCTGACCGCATGATCGACATGGGCTTCGAGGGTGACATCCGTACCATCTTCTCCTACTTCAAG
                                                                           
                                                                           
---------------------------------------------------------------------------