Exon Sequence
>ENSE00001300026 NT
GCTGCGGCCGCAGCCATGAG
CATGCTCGGGCCTCAGAAGA
GGCTCGCCTCTAGTGTCCTC
CGCTGTGGCAAGAAGAAGGT
CTGGTTAGACCCCAGTGAGA
CCAATGAAATCGCCAATGCC
AACTCCCGTCAGCAGATCCG
GAAGCTCATCAAAGACGGGC
TGATCATCCGCAAGCCTGTG
ACGGTCCATTCCCGGGCTCG
ATGCCGGAAAAACACCTTGG
CCCGCCGGAAGGGCAGGCAC
GTGGCCATAGGTGAGCAGAA
GGGTACAGCCAATGCCCGAA
TGCCAGAGAAGGTCACATGG
ATGAGGAGAATGACGATTTT
GCGCCGGCTGCTCAGAAGAT
ACCGTGAATCTAAGAAGATC
GATCGCCACACGTATCACAG
CCTGTACCTGAAGGTGAAGG
GGAATGTGTTCAAAGACAAG
CGGATTCTCATGGAACACAT
CCACAAGCTGAAGGCAGACA
AGGCCCGCAAGAAGCTCCTG
GCTGACCAGGCTGAGGCCCG
CAGGTCTAAGACCAAGGAAG
CAGGCAAGTGCCCTGAAGAG
CGCCTCCAGGCCAAGAAGGA
GGAGTTCATCAAGACTTTAT
CCAAGGAGGAAGAGACCAAG
AAATAA
>ENSE00001300026 AA
AAAAAMSMLGPQKRLASSVL
RCGKKKVWLDPSETNEIANA
NSRQQIRKLIKDGLIIRKPV
TVHSRARCRKNTLARRKGRH
VAIGEQKGTANARMPEKVTW
MRRMTILRRLLRRYRESKKI
DRHTYHSLYLKVKGNVFKDK
RILMEHIHKLKADKARKKLL
ADQAEARRSKTKEAGKCPEE
RLQAKKEEFIKTLSKEEETK
K*

ENSE00001300026

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002035178 est Identity : 93.035%

-A--A--A--A--A--M--S--M--L--G--P--Q--K--R--L--A--S--S--V--L--R--C--G--K--K--K--V--W--L--D-
GCTGCGGCCGCAGCCATGAGCATGCTCGGGCCTCAGAAGAGGCTCGCCTCTAGTGTCCTCCGCTGTGGCAAGAAGAAGGTCTGGTTAGAC
   ::::: :::::::::::.::::::.:::.::::::::::::.:::::.::::::::::::::::::::.:::::.::::::::.:::
   GCGGCAGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTTGCCTCCAGTGTCCTCCGCTGTGGCAAAAAGAAAGTCTGGTTGGAC
----A--A--A--A--M--S--M--L--R--L--Q--K--R--L--A--S--S--V--L--R--C--G--K--K--K--V--W--L--D-

-P--S--E--T--N--E--I--A--N--A--N--S--R--Q--Q--I--R--K--L--I--K--D--G--L--I--I--R--K--P--V-
CCCAGTGAGACCAATGAAATCGCCAATGCCAACTCCCGTCAGCAGATCCGGAAGCTCATCAAAGACGGGCTGATCATCCGCAAGCCTGTG
::::.::::::.::::::::::::::.::::::::::::::::::::::::::::: ::::::::.:::::::::::::: :::::::::
CCCAATGAGACTAATGAAATCGCCAACGCCAACTCCCGTCAGCAGATCCGGAAGCTGATCAAAGATGGGCTGATCATCCGGAAGCCTGTG
-P--N--E--T--N--E--I--A--N--A--N--S--R--Q--Q--I--R--K--L--I--K--D--G--L--I--I--R--K--P--V-

-T--V--H--S--R--A--R--C--R--K--N--T--L--A--R--R--K--G--R--H--V--A--I--G--E--Q--K--G--T--A-
ACGGTCCATTCCCGGGCTCGATGCCGGAAAAACACCTTGGCCCGCCGGAAGGGCAGGCACGTGGCCATAGGTGAGCAGAAGGGTACAGCC
:: :::::::::::::::::::::::::::::::::.::::::::::::::::::::::..::: ::: :::.:::.::::::::: :::
ACTGTCCATTCCCGGGCTCGATGCCGGAAAAACACCCTGGCCCGCCGGAAGGGCAGGCATATGGGCATCGGTAAGCGGAAGGGTACTGCC
-T--V--H--S--R--A--R--C--R--K--N--T--L--A--R--R--K--G--R--H--M--G--I--G--K--R--K--G--T--A-

-N--A--R--M--P--E--K--V--T--W--M--R--R--M--T--I--L--R--R--L--L--R--R--Y--R--E--S--K--K--I-
AATGCCCGAATGCCAGAGAAGGTCACATGGATGAGGAGAATGACGATTTTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAGAAGATC
:::::.:::::::: :::::::: :: :::::::::::.:::: .:::.::::::::::::::::::::::::::::::::::::::::.
AATGCTCGAATGCCTGAGAAGGTAACTTGGATGAGGAGGATGAGAATTCTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAGAAGATT
-N--A--R--M--P--E--K--V--T--W--M--R--R--M--R--I--L--R--R--L--L--R--R--Y--R--E--S--K--K--I-

-D--R--H--T--Y--H--S--L--Y--L--K--V--K--G--N--V--F--K--D--K--R--I--L--M--E--H--I--H--K--L-
GATCGCCACACGTATCACAGCCTGTACCTGAAGGTGAAGGGGAATGTGTTCAAAGACAAGCGGATTCTCATGGAACACATCCACAAGCTG
::.:::::::.:::::::::.:::::::::::.:::::::::::::::::::::.:::::::::::::::::::.:::::::::::::::
GACCGCCACATGTATCACAGTCTGTACCTGAAAGTGAAGGGGAATGTGTTCAAAAACAAGCGGATTCTCATGGAGCACATCCACAAGCTG
-D--R--H--M--Y--H--S--L--Y--L--K--V--K--G--N--V--F--K--N--K--R--I--L--M--E--H--I--H--K--L-

-K--A--D--K--A--R--K--K--L--L--A--D--Q--A--E--A--R--R--S--K--T--K--E--A--G--K--C--P--E--E-
AAGGCAGACAAGGCCCGCAAGAAGCTCCTGGCTGACCAGGCTGAGGCCCGCAGGTCTAAGACCAAGGAAGCAGGCAAGTGCCCTGAAGAG
:::::.::::::::.:::::::::::.::::: ::::::::::::::::::::::::::::::::::::::: :::::.::: :::::::
AAGGCGGACAAGGCTCGCAAGAAGCTTCTGGCGGACCAGGCTGAGGCCCGCAGGTCTAAGACCAAGGAAGCACGCAAGCGCCGTGAAGAG
-K--A--D--K--A--R--K--K--L--L--A--D--Q--A--E--A--R--R--S--K--T--K--E--A--R--K--R--R--E--E-

-R--L--Q--A--K--K--E--E--F--I--K--T--L--S--K--E--E--E--T--K--K--*-
CGCCTCCAGGCCAAGAAGGAGGAGTTCATCAAGACTTTATCCAAGGAGGAAGAGACCAAGAAATAA
:: ::::::::::::::::::::. :::::::::::.:.:::::::::::::::::::::::::::
CGGCTCCAGGCCAAGAAGGAGGAAATCATCAAGACTCTGTCCAAGGAGGAAGAGACCAAGAAATAA
-R--L--Q--A--K--K--E--E--I--I--K--T--L--S--K--E--E--E--T--K--K--*-

BGISUSX0001099738 both Identity : 93.035%

-A--A--A--A--A--M--S--M--L--G--P--Q--K--R--L--A--S--S--V--L--R--C--G--K--K--K--V--W--L--D-
GCTGCGGCCGCAGCCATGAGCATGCTCGGGCCTCAGAAGAGGCTCGCCTCTAGTGTCCTCCGCTGTGGCAAGAAGAAGGTCTGGTTAGAC
   ::::: :::::::::::.::::::.:::.::::::::::::.:::::.::::::::::::::::::::.:::::.::::::::.:::
   GCGGCAGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTTGCCTCCAGTGTCCTCCGCTGTGGCAAAAAGAAAGTCTGGTTGGAC
----A--A--A--A--M--S--M--L--R--L--Q--K--R--L--A--S--S--V--L--R--C--G--K--K--K--V--W--L--D-

-P--S--E--T--N--E--I--A--N--A--N--S--R--Q--Q--I--R--K--L--I--K--D--G--L--I--I--R--K--P--V-
CCCAGTGAGACCAATGAAATCGCCAATGCCAACTCCCGTCAGCAGATCCGGAAGCTCATCAAAGACGGGCTGATCATCCGCAAGCCTGTG
::::.::::::.::::::::::::::.::::::::::::::::::::::::::::: ::::::::.:::::::::::::: :::::::::
CCCAATGAGACTAATGAAATCGCCAACGCCAACTCCCGTCAGCAGATCCGGAAGCTGATCAAAGATGGGCTGATCATCCGGAAGCCTGTG
-P--N--E--T--N--E--I--A--N--A--N--S--R--Q--Q--I--R--K--L--I--K--D--G--L--I--I--R--K--P--V-

-T--V--H--S--R--A--R--C--R--K--N--T--L--A--R--R--K--G--R--H--V--A--I--G--E--Q--K--G--T--A-
ACGGTCCATTCCCGGGCTCGATGCCGGAAAAACACCTTGGCCCGCCGGAAGGGCAGGCACGTGGCCATAGGTGAGCAGAAGGGTACAGCC
:: :::::::::::::::::::::::::::::::::.::::::::::::::::::::::..::: ::: :::.:::.::::::::: :::
ACTGTCCATTCCCGGGCTCGATGCCGGAAAAACACCCTGGCCCGCCGGAAGGGCAGGCATATGGGCATCGGTAAGCGGAAGGGTACTGCC
-T--V--H--S--R--A--R--C--R--K--N--T--L--A--R--R--K--G--R--H--M--G--I--G--K--R--K--G--T--A-

-N--A--R--M--P--E--K--V--T--W--M--R--R--M--T--I--L--R--R--L--L--R--R--Y--R--E--S--K--K--I-
AATGCCCGAATGCCAGAGAAGGTCACATGGATGAGGAGAATGACGATTTTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAGAAGATC
:::::.:::::::: :::::::: :: :::::::::::.:::: .:::.::::::::::::::::::::::::::::::::::::::::.
AATGCTCGAATGCCTGAGAAGGTAACTTGGATGAGGAGGATGAGAATTCTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAGAAGATT
-N--A--R--M--P--E--K--V--T--W--M--R--R--M--R--I--L--R--R--L--L--R--R--Y--R--E--S--K--K--I-

-D--R--H--T--Y--H--S--L--Y--L--K--V--K--G--N--V--F--K--D--K--R--I--L--M--E--H--I--H--K--L-
GATCGCCACACGTATCACAGCCTGTACCTGAAGGTGAAGGGGAATGTGTTCAAAGACAAGCGGATTCTCATGGAACACATCCACAAGCTG
::.:::::::.:::::::::.:::::::::::.:::::::::::::::::::::.:::::::::::::::::::.:::::::::::::::
GACCGCCACATGTATCACAGTCTGTACCTGAAAGTGAAGGGGAATGTGTTCAAAAACAAGCGGATTCTCATGGAGCACATCCACAAGCTG
-D--R--H--M--Y--H--S--L--Y--L--K--V--K--G--N--V--F--K--N--K--R--I--L--M--E--H--I--H--K--L-

-K--A--D--K--A--R--K--K--L--L--A--D--Q--A--E--A--R--R--S--K--T--K--E--A--G--K--C--P--E--E-
AAGGCAGACAAGGCCCGCAAGAAGCTCCTGGCTGACCAGGCTGAGGCCCGCAGGTCTAAGACCAAGGAAGCAGGCAAGTGCCCTGAAGAG
:::::.::::::::.:::::::::::.::::: ::::::::::::::::::::::::::::::::::::::: :::::.::: :::::::
AAGGCGGACAAGGCTCGCAAGAAGCTTCTGGCGGACCAGGCTGAGGCCCGCAGGTCTAAGACCAAGGAAGCACGCAAGCGCCGTGAAGAG
-K--A--D--K--A--R--K--K--L--L--A--D--Q--A--E--A--R--R--S--K--T--K--E--A--R--K--R--R--E--E-

-R--L--Q--A--K--K--E--E--F--I--K--T--L--S--K--E--E--E--T--K--K--*-
CGCCTCCAGGCCAAGAAGGAGGAGTTCATCAAGACTTTATCCAAGGAGGAAGAGACCAAGAAATAA
:: ::::::::::::::::::::. :::::::::::.:.:::::::::::::::::::::::::::
CGGCTCCAGGCCAAGAAGGAGGAAATCATCAAGACTCTGTCCAAGGAGGAAGAGACCAAGAAATAA
-R--L--Q--A--K--K--E--E--I--I--K--T--L--S--K--E--E--E--T--K--K--*-

BGISUSX0000129150 all Identity : 93.035%

-A--A--A--A--A--M--S--M--L--G--P--Q--K--R--L--A--S--S--V--L--R--C--G--K--K--K--V--W--L--D-
GCTGCGGCCGCAGCCATGAGCATGCTCGGGCCTCAGAAGAGGCTCGCCTCTAGTGTCCTCCGCTGTGGCAAGAAGAAGGTCTGGTTAGAC
   ::::: :::::::::::.::::::.:::.::::::::::::.:::::.::::::::::::::::::::.:::::.::::::::.:::
   GCGGCAGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTTGCCTCCAGTGTCCTCCGCTGTGGCAAAAAGAAAGTCTGGTTGGAC
----A--A--A--A--M--S--M--L--R--L--Q--K--R--L--A--S--S--V--L--R--C--G--K--K--K--V--W--L--D-

-P--S--E--T--N--E--I--A--N--A--N--S--R--Q--Q--I--R--K--L--I--K--D--G--L--I--I--R--K--P--V-
CCCAGTGAGACCAATGAAATCGCCAATGCCAACTCCCGTCAGCAGATCCGGAAGCTCATCAAAGACGGGCTGATCATCCGCAAGCCTGTG
::::.::::::.::::::::::::::.::::::::::::::::::::::::::::: ::::::::.:::::::::::::: :::::::::
CCCAATGAGACTAATGAAATCGCCAACGCCAACTCCCGTCAGCAGATCCGGAAGCTGATCAAAGATGGGCTGATCATCCGGAAGCCTGTG
-P--N--E--T--N--E--I--A--N--A--N--S--R--Q--Q--I--R--K--L--I--K--D--G--L--I--I--R--K--P--V-

-T--V--H--S--R--A--R--C--R--K--N--T--L--A--R--R--K--G--R--H--V--A--I--G--E--Q--K--G--T--A-
ACGGTCCATTCCCGGGCTCGATGCCGGAAAAACACCTTGGCCCGCCGGAAGGGCAGGCACGTGGCCATAGGTGAGCAGAAGGGTACAGCC
:: :::::::::::::::::::::::::::::::::.::::::::::::::::::::::..::: ::: :::.:::.::::::::: :::
ACTGTCCATTCCCGGGCTCGATGCCGGAAAAACACCCTGGCCCGCCGGAAGGGCAGGCATATGGGCATCGGTAAGCGGAAGGGTACTGCC
-T--V--H--S--R--A--R--C--R--K--N--T--L--A--R--R--K--G--R--H--M--G--I--G--K--R--K--G--T--A-

-N--A--R--M--P--E--K--V--T--W--M--R--R--M--T--I--L--R--R--L--L--R--R--Y--R--E--S--K--K--I-
AATGCCCGAATGCCAGAGAAGGTCACATGGATGAGGAGAATGACGATTTTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAGAAGATC
:::::.:::::::: :::::::: :: :::::::::::.:::: .:::.::::::::::::::::::::::::::::::::::::::::.
AATGCTCGAATGCCTGAGAAGGTAACTTGGATGAGGAGGATGAGAATTCTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAGAAGATT
-N--A--R--M--P--E--K--V--T--W--M--R--R--M--R--I--L--R--R--L--L--R--R--Y--R--E--S--K--K--I-

-D--R--H--T--Y--H--S--L--Y--L--K--V--K--G--N--V--F--K--D--K--R--I--L--M--E--H--I--H--K--L-
GATCGCCACACGTATCACAGCCTGTACCTGAAGGTGAAGGGGAATGTGTTCAAAGACAAGCGGATTCTCATGGAACACATCCACAAGCTG
::.:::::::.:::::::::.:::::::::::.:::::::::::::::::::::.:::::::::::::::::::.:::::::::::::::
GACCGCCACATGTATCACAGTCTGTACCTGAAAGTGAAGGGGAATGTGTTCAAAAACAAGCGGATTCTCATGGAGCACATCCACAAGCTG
-D--R--H--M--Y--H--S--L--Y--L--K--V--K--G--N--V--F--K--N--K--R--I--L--M--E--H--I--H--K--L-

-K--A--D--K--A--R--K--K--L--L--A--D--Q--A--E--A--R--R--S--K--T--K--E--A--G--K--C--P--E--E-
AAGGCAGACAAGGCCCGCAAGAAGCTCCTGGCTGACCAGGCTGAGGCCCGCAGGTCTAAGACCAAGGAAGCAGGCAAGTGCCCTGAAGAG
:::::.::::::::.:::::::::::.::::: ::::::::::::::::::::::::::::::::::::::: :::::.::: :::::::
AAGGCGGACAAGGCTCGCAAGAAGCTTCTGGCGGACCAGGCTGAGGCCCGCAGGTCTAAGACCAAGGAAGCACGCAAGCGCCGTGAAGAG
-K--A--D--K--A--R--K--K--L--L--A--D--Q--A--E--A--R--R--S--K--T--K--E--A--R--K--R--R--E--E-

-R--L--Q--A--K--K--E--E--F--I--K--T--L--S--K--E--E--E--T--K--K--*-
CGCCTCCAGGCCAAGAAGGAGGAGTTCATCAAGACTTTATCCAAGGAGGAAGAGACCAAGAAATAA
:: ::::::::::::::::::::. :::::::::::.:.:::::::::::::::::::::::::::
CGGCTCCAGGCCAAGAAGGAGGAAATCATCAAGACTCTGTCCAAGGAGGAAGAGACCAAGAAATAA
-R--L--Q--A--K--K--E--E--I--I--K--T--L--S--K--E--E--E--T--K--K--*-

BGISUSX0002035178 est Identity : 41.176%

-A--A--A--A--A--M--S--M--L--G--P--Q--K--R--L--A--S--S--V--L--R--C--G--K--K--K--V--W--L--D-
GCTGCGGCCGCAGCCATGAGCATGCTCGGGCCTCAGAAGAGGCTCGCCTCTAGTGTCCTCCGCTGTGGCAAGAAGAAGGTCTGGTTAGAC
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-P--S--E--T--N--E--I--A--N--A--N--S--R--Q--Q--I--R--K--L--I--K--D--G--L--I--I--R--K--P--V-
CCCAGTGAGACCAATGAAATCGCCAATGCCAACTCCCGTCAGCAGATCCGGAAGCTCATCAAAGACGGGCTGATCATCCGCAAGCCTGTG
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-T--V--H--S--R--A--R--C--R--K--N--T--L--A--R--R--K--G--R--H--V--A--I--G--E--Q--K--G--T--A-
ACGGTCCATTCCCGGGCTCGATGCCGGAAAAACACCTTGGCCCGCCGGAAGGGCAGGCACGTGGCCATAGGTGAGCAGAAGGGTACAGCC
                                                      :::::. .:. ::: ::...           . .::
                                                      AGGCATTCGAGCATTGGCAGTACCCTTCCGCTTACC
-------------------------------------------------------R--H--S--S--I--G--S--T--L--P--L--T-

-N--A--R--M--P--E--K--V--T--W--M--R--R--M--T--I--L--R--R--L--L--R--R--Y--R--E--S--K--K--I-
AATGCCCGAATGCCAGAGAAGGTCACATGGATGAGGAGAATGACGATTTTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAGAAGATC
.::::::. :::::                                                                            
GATGCCCATATGCCT                                                                           
-D--A--H--M--P----------------------------------------------------------------------------

-D--R--H--T--Y--H--S--L--Y--L--K--V--K--G--N--V--F--K--D--K--R--I--L--M--E--H--I--H--K--L-
GATCGCCACACGTATCACAGCCTGTACCTGAAGGTGAAGGGGAATGTGTTCAAAGACAAGCGGATTCTCATGGAACACATCCACAAGCTG
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-K--A--D--K--A--R--K--K--L--L--A--D--Q--A--E--A--R--R--S--K--T--K--E--A--G--K--C--P--E--E-
AAGGCAGACAAGGCCCGCAAGAAGCTCCTGGCTGACCAGGCTGAGGCCCGCAGGTCTAAGACCAAGGAAGCAGGCAAGTGCCCTGAAGAG
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-R--L--Q--A--K--K--E--E--F--I--K--T--L--S--K--E--E--E--T--K--K--*-
CGCCTCCAGGCCAAGAAGGAGGAGTTCATCAAGACTTTATCCAAGGAGGAAGAGACCAAGAAATAA
                                                                  
                                                                  
------------------------------------------------------------------

BGISUSX0001099738 both Identity : 41.176%

-A--A--A--A--A--M--S--M--L--G--P--Q--K--R--L--A--S--S--V--L--R--C--G--K--K--K--V--W--L--D-
GCTGCGGCCGCAGCCATGAGCATGCTCGGGCCTCAGAAGAGGCTCGCCTCTAGTGTCCTCCGCTGTGGCAAGAAGAAGGTCTGGTTAGAC
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-P--S--E--T--N--E--I--A--N--A--N--S--R--Q--Q--I--R--K--L--I--K--D--G--L--I--I--R--K--P--V-
CCCAGTGAGACCAATGAAATCGCCAATGCCAACTCCCGTCAGCAGATCCGGAAGCTCATCAAAGACGGGCTGATCATCCGCAAGCCTGTG
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-T--V--H--S--R--A--R--C--R--K--N--T--L--A--R--R--K--G--R--H--V--A--I--G--E--Q--K--G--T--A-
ACGGTCCATTCCCGGGCTCGATGCCGGAAAAACACCTTGGCCCGCCGGAAGGGCAGGCACGTGGCCATAGGTGAGCAGAAGGGTACAGCC
                                                      :::::. .:. ::: ::...           . .::
                                                      AGGCATTCGAGCATTGGCAGTACCCTTCCGCTTACC
-------------------------------------------------------R--H--S--S--I--G--S--T--L--P--L--T-

-N--A--R--M--P--E--K--V--T--W--M--R--R--M--T--I--L--R--R--L--L--R--R--Y--R--E--S--K--K--I-
AATGCCCGAATGCCAGAGAAGGTCACATGGATGAGGAGAATGACGATTTTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAGAAGATC
.::::::. :::::                                                                            
GATGCCCATATGCCT                                                                           
-D--A--H--M--P----------------------------------------------------------------------------

-D--R--H--T--Y--H--S--L--Y--L--K--V--K--G--N--V--F--K--D--K--R--I--L--M--E--H--I--H--K--L-
GATCGCCACACGTATCACAGCCTGTACCTGAAGGTGAAGGGGAATGTGTTCAAAGACAAGCGGATTCTCATGGAACACATCCACAAGCTG
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-K--A--D--K--A--R--K--K--L--L--A--D--Q--A--E--A--R--R--S--K--T--K--E--A--G--K--C--P--E--E-
AAGGCAGACAAGGCCCGCAAGAAGCTCCTGGCTGACCAGGCTGAGGCCCGCAGGTCTAAGACCAAGGAAGCAGGCAAGTGCCCTGAAGAG
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-R--L--Q--A--K--K--E--E--F--I--K--T--L--S--K--E--E--E--T--K--K--*-
CGCCTCCAGGCCAAGAAGGAGGAGTTCATCAAGACTTTATCCAAGGAGGAAGAGACCAAGAAATAA
                                                                  
                                                                  
------------------------------------------------------------------

BGISUSX0000129150 all Identity : 41.176%

-A--A--A--A--A--M--S--M--L--G--P--Q--K--R--L--A--S--S--V--L--R--C--G--K--K--K--V--W--L--D-
GCTGCGGCCGCAGCCATGAGCATGCTCGGGCCTCAGAAGAGGCTCGCCTCTAGTGTCCTCCGCTGTGGCAAGAAGAAGGTCTGGTTAGAC
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-P--S--E--T--N--E--I--A--N--A--N--S--R--Q--Q--I--R--K--L--I--K--D--G--L--I--I--R--K--P--V-
CCCAGTGAGACCAATGAAATCGCCAATGCCAACTCCCGTCAGCAGATCCGGAAGCTCATCAAAGACGGGCTGATCATCCGCAAGCCTGTG
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-T--V--H--S--R--A--R--C--R--K--N--T--L--A--R--R--K--G--R--H--V--A--I--G--E--Q--K--G--T--A-
ACGGTCCATTCCCGGGCTCGATGCCGGAAAAACACCTTGGCCCGCCGGAAGGGCAGGCACGTGGCCATAGGTGAGCAGAAGGGTACAGCC
                                                      :::::. .:. ::: ::...           . .::
                                                      AGGCATTCGAGCATTGGCAGTACCCTTCCGCTTACC
-------------------------------------------------------R--H--S--S--I--G--S--T--L--P--L--T-

-N--A--R--M--P--E--K--V--T--W--M--R--R--M--T--I--L--R--R--L--L--R--R--Y--R--E--S--K--K--I-
AATGCCCGAATGCCAGAGAAGGTCACATGGATGAGGAGAATGACGATTTTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAGAAGATC
.::::::. :::::                                                                            
GATGCCCATATGCCT                                                                           
-D--A--H--M--P----------------------------------------------------------------------------

-D--R--H--T--Y--H--S--L--Y--L--K--V--K--G--N--V--F--K--D--K--R--I--L--M--E--H--I--H--K--L-
GATCGCCACACGTATCACAGCCTGTACCTGAAGGTGAAGGGGAATGTGTTCAAAGACAAGCGGATTCTCATGGAACACATCCACAAGCTG
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-K--A--D--K--A--R--K--K--L--L--A--D--Q--A--E--A--R--R--S--K--T--K--E--A--G--K--C--P--E--E-
AAGGCAGACAAGGCCCGCAAGAAGCTCCTGGCTGACCAGGCTGAGGCCCGCAGGTCTAAGACCAAGGAAGCAGGCAAGTGCCCTGAAGAG
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

-R--L--Q--A--K--K--E--E--F--I--K--T--L--S--K--E--E--E--T--K--K--*-
CGCCTCCAGGCCAAGAAGGAGGAGTTCATCAAGACTTTATCCAAGGAGGAAGAGACCAAGAAATAA
                                                                  
                                                                  
------------------------------------------------------------------