Exon Sequence
>ENSE00001301397 NT
TTGATGTCAGTGAAGGAGAT
GGCTAAGGGCATTACGTATG
ATGACCCCATCAAAACC
>ENSE00001301397 AA
-LMSVKEMAKGITYDDPIKT

ENSE00001301397

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003020212 reads Identity : 100%

-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K--T---
-CATTGATGTCAGTGAAGGAGATGGCTAAGGGCATTACGTATGATGACCCCATCAAAACCAG
 : ::::::::::::::::::::::::::::: ::.::.::.::.::::: ::::::     
GCCTTGATGTCAGTGAAGGAGATGGCTAAGGGAATCACATACGACGACCCGATCAAA     
-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K------

BGISUSX0002030866 est Identity : 100%

-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K--T---
-CATTGATGTCAGTGAAGGAGATGGCTAAGGGCATTACGTATGATGACCCCATCAAAACCAG
 : ::::::::::::::::::::::::::::: ::.::.::.::.::::: ::::::     
GCCTTGATGTCAGTGAAGGAGATGGCTAAGGGAATCACATACGACGACCCGATCAAA     
-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K------

BGISUSX0002030867 est Identity : 100%

-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K--T---
-CATTGATGTCAGTGAAGGAGATGGCTAAGGGCATTACGTATGATGACCCCATCAAAACCAG
 : ::::::::::::::::::::::::::::: ::.::.::.::.::::: ::::::     
GCCTTGATGTCAGTGAAGGAGATGGCTAAGGGAATCACATACGACGACCCGATCAAA     
-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K------

BGISUSX0001020528 both Identity : 100%

-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K--T---
-CATTGATGTCAGTGAAGGAGATGGCTAAGGGCATTACGTATGATGACCCCATCAAAACCAG
 : ::::::::::::::::::::::::::::: ::.::.::.::.::::: ::::::     
GCCTTGATGTCAGTGAAGGAGATGGCTAAGGGAATCACATACGACGACCCGATCAAA     
-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K------

BGISUSX0001020529 both Identity : 100%

-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K--T---
-CATTGATGTCAGTGAAGGAGATGGCTAAGGGCATTACGTATGATGACCCCATCAAAACCAG
 : ::::::::::::::::::::::::::::: ::.::.::.::.::::: ::::::     
GCCTTGATGTCAGTGAAGGAGATGGCTAAGGGAATCACATACGACGACCCGATCAAA     
-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K------

BGISUSX0000027003 all Identity : 100%

-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K--T---
-CATTGATGTCAGTGAAGGAGATGGCTAAGGGCATTACGTATGATGACCCCATCAAAACCAG
 : ::::::::::::::::::::::::::::: ::.::.::.::.::::: ::::::     
GCCTTGATGTCAGTGAAGGAGATGGCTAAGGGAATCACATACGACGACCCGATCAAA     
-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K------

BGISUSX0000027004 all Identity : 100%

-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K--T---
-CATTGATGTCAGTGAAGGAGATGGCTAAGGGCATTACGTATGATGACCCCATCAAAACCAG
 : ::::::::::::::::::::::::::::: ::.::.::.::.::::: ::::::     
GCCTTGATGTCAGTGAAGGAGATGGCTAAGGGAATCACATACGACGACCCGATCAAA     
-A--L--M--S--V--K--E--M--A--K--G--I--T--Y--D--D--P--I--K------