Exon Sequence
>ENSE00001303027 NT
ATCGAATTCCTGAAAGGATT
TCGGGTAATACTGGAGGAGC
TGAAGTCGGAGGGAAGACAG
TGCCAACAACTGATTCTAAA
GGATCCGAAGCAGCTCAACA
GTAGCTTCAAAAGAACT
>ENSE00001303027 AA
-IEFLKGFRVILEELKSEGR
QCQQLILKDPKQLNSSFKRT

ENSE00001303027

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0000133364 all Identity : 100%

-G--I--E--F--L--K--G--F--R--V--I--L--E--E--L--K--S--E--G--R--Q--C--Q--Q--L--I--L--K--D--P-
-GCATCGAATTCCTGAAAGGATTTCGGGTAATACTGGAGGAGCTGAAGTCGGAGGGAAGACAGTGCCAACAACTGATTCTAAAGGATCCG
 :::::::::::::.:::::::::::::::::::::::::::::::::::.::.::::::::::::::::::::::::::.:::::.:::
GGCATCGAATTCCTAAAAGGATTTCGGGTAATACTGGAGGAGCTGAAGTCAGAAGGAAGACAGTGCCAACAACTGATTCTGAAGGACCCG
-G--I--E--F--L--K--G--F--R--V--I--L--E--E--L--K--S--E--G--R--Q--C--Q--Q--L--I--L--K--D--P-

-K--Q--L--N--S--S--F--K--R--T-
AAGCAGCTCAACAGTAGCTTCAAAAGAACT
:::::::::::::::::::::::::::   
AAGCAGCTCAACAGTAGCTTCAAAAGA   
-K--Q--L--N--S--S--F--K--R----

BGISUSX0003025946 reads Identity : 97.436%

-G--I--E--F--L--K--G--F--R--V--I--L--E--E--L--K--S--E--G--R--Q--C--Q--Q--L--I--L--K--D--P-
-GCATCGAATTCCTGAAAGGATTTCGGGTAATACTGGAGGAGCTGAAGTCGGAGGGAAGACAGTGCCAACAACTGATTCTAAAGGATCCG
 :::::::::::::.:::::::::::::::::::::::::::::::::::.::.:::::::::::::::: :::::::::.:::::.:::
GGCATCGAATTCCTAAAAGGATTTCGGGTAATACTGGAGGAGCTGAAGTCAGAAGGAAGACAGTGCCAACCACTGATTCTGAAGGACCCG
-G--I--E--F--L--K--G--F--R--V--I--L--E--E--L--K--S--E--G--R--Q--C--Q--P--L--I--L--K--D--P-

-K--Q--L--N--S--S--F--K--R--T-
AAGCAGCTCAACAGTAGCTTCAAAAGAACT
:::::::::::::::::::::::::::   
AAGCAGCTCAACAGTAGCTTCAAAAGA   
-K--Q--L--N--S--S--F--K--R----

BGISUSX0001102906 both Identity : 97.436%

-G--I--E--F--L--K--G--F--R--V--I--L--E--E--L--K--S--E--G--R--Q--C--Q--Q--L--I--L--K--D--P-
-GCATCGAATTCCTGAAAGGATTTCGGGTAATACTGGAGGAGCTGAAGTCGGAGGGAAGACAGTGCCAACAACTGATTCTAAAGGATCCG
 :::::::::::::.:::::::::::::::::::::::::::::::::::.::.:::::::::::::::: :::::::::.:::::.:::
GGCATCGAATTCCTAAAAGGATTTCGGGTAATACTGGAGGAGCTGAAGTCAGAAGGAAGACAGTGCCAACCACTGATTCTGAAGGACCCG
-G--I--E--F--L--K--G--F--R--V--I--L--E--E--L--K--S--E--G--R--Q--C--Q--P--L--I--L--K--D--P-

-K--Q--L--N--S--S--F--K--R--T-
AAGCAGCTCAACAGTAGCTTCAAAAGAACT
:::::::::::::::::::::::::::   
AAGCAGCTCAACAGTAGCTTCAAAAGA   
-K--Q--L--N--S--S--F--K--R----

BGISUSX0003025946 reads Identity : 40%

----I--E--F--L--K--G--F--R--V--I--L--E--E--L--K--S--E--G--R--Q--C--Q--Q--L--I--L--K--D--P-
-GCATCGAATTCCTGAAAGGATTTCGGGTAATACTGGAGGAGCTGAAGTCGGAGGGAAGACAGTGCCAACAACTGATTCTAAAGGATCCG
                                                                     ::.::  :.: . :  :.:::
                                                                     CAGCTCCTCCAGTATTACCCG
----------------------------------------------------------------------Q--L--L--Q--Y--Y--P-

-K--Q--L--N--S--S--F--K--R--T-
AAGCAGCTCAACAGTAGCTTCAAAAGAACT
::..  .:.                     
AAATCCTTT                     
-K--S--F----------------------

BGISUSX0001102906 both Identity : 40%

----I--E--F--L--K--G--F--R--V--I--L--E--E--L--K--S--E--G--R--Q--C--Q--Q--L--I--L--K--D--P-
-GCATCGAATTCCTGAAAGGATTTCGGGTAATACTGGAGGAGCTGAAGTCGGAGGGAAGACAGTGCCAACAACTGATTCTAAAGGATCCG
                                                                     ::.::  :.: . :  :.:::
                                                                     CAGCTCCTCCAGTATTACCCG
----------------------------------------------------------------------Q--L--L--Q--Y--Y--P-

-K--Q--L--N--S--S--F--K--R--T-
AAGCAGCTCAACAGTAGCTTCAAAAGAACT
::..  .:.                     
AAATCCTTT                     
-K--S--F----------------------