Exon Sequence
>ENSE00001310273 NT
TTGGAGGCTGTTGTCATTGG
AGAAGTTCATGAGAATGTTA
CTCTGCACTGTGGCAACATC
TCGGGACTGAGGGGCCAGGT
GACCTGGTACCGGAACAACT
CGGAGCCTGTCTTCCTTCTC
TCGTCCAACTCTAGCCTCCG
GCCAGCTGAGCCTCGCTTCT
CTCTAGTGGATGCCACCTCC
CTGCACATTGAATCGCTGAG
CCTGGGAGATGAGGGAATCT
ACACCTGCCAGGAGATCCTG
AATGTGACTCAGTGGTTCCA
AGTGTGGCTGCAGGTGGCC
>ENSE00001310273 AA
-LEAVVIGEVHENVTLHCGN
ISGLRGQVTWYRNNSEPVFL
LSSNSSLRPAEPRFSLVDAT
SLHIESLSLGDEGIYTCQEI
LNVTQWFQVWLQVA

ENSE00001310273

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003031766 reads Identity : 78.723%

-G--L--E--A--V--V--I--G--E--V--H--E--N--V--T--L--H--C--G--N--I--S--G--L--R--G--Q--V--T--W-
-GATTGGAGGCTGTTGTCATTGGAGAAGTTCATGAGAATGTTACTCTGCACTGTGGCAACATCTCGGGACTGAGGGGCCAGGTGACCTGG
 ::.:::::::::.::::::.::::::::::: ::::::::.:: :::: :::::::::::::::.::::.::::::::  :::::::::
GGACTGGAGGCTGCTGTCATCGGAGAAGTTCAAGAGAATGTCACGCTGCTCTGTGGCAACATCTCAGGACCGAGGGGCCTCGTGACCTGG
-G--L--E--A--A--V--I--G--E--V--Q--E--N--V--T--L--L--C--G--N--I--S--G--P--R--G--L--V--T--W-

-Y--R--N--N--S--E--P--V--F--L--L--S--S--N--S--S--L--R--P--A--E--P--R--F--S--L--V--D--A--T-
TACCGGAACAACTCGGAGCCTGTCTTCCTTCTCTCGTCCAACTCTAGCCTCCGGCCAGCTGAGCCTCGCTTCTCTCTAGTGGATGCCACC
::.:::::..:::::::::::::::::::. : :: :::::.::.::.:: : :.::::. :::: ::::::: :::.:::.:::::: :
TATCGGAATGACTCGGAGCCTGTCTTCCTCGTGTCCTCCAATTCCAGTCTGCCGTCAGCCCAGCCACGCTTCTGTCTGGTGAATGCCAGC
-Y--R--N--D--S--E--P--V--F--L--V--S--S--N--S--S--L--P--S--A--Q--P--R--F--C--L--V--N--A--S-

-S--L--H--I--E--S--L--S--L--G--D--E--G--I--Y--T--C--Q--E--I--L--N--V--T--Q--W--F--Q--V--W-
TCCCTGCACATTGAATCGCTGAGCCTGGGAGATGAGGGAATCTACACCTGCCAGGAGATCCTGAATGTGACTCAGTGGTTCCAAGTGTGG
::::::::::::::. :.::::::::: ..::::::::.: ::::::::::..::::.:::::::.: :::::.::::::::::::::::
TCCCTGCACATTGAGGCACTGAGCCTGCAGGATGAGGGGAACTACACCTGCTGGGAGGTCCTGAACGAGACTCGGTGGTTCCAAGTGTGG
-S--L--H--I--E--A--L--S--L--Q--D--E--G--N--Y--T--C--W--E--V--L--N--E--T--R--W--F--Q--V--W-

-L--Q--V--A--
CTGCAGGTGGCCA
:::::::::::: 
CTGCAGGTGGCC 
-L--Q--V--A--

BGISUSX0001109146 both Identity : 78.723%

-G--L--E--A--V--V--I--G--E--V--H--E--N--V--T--L--H--C--G--N--I--S--G--L--R--G--Q--V--T--W-
-GATTGGAGGCTGTTGTCATTGGAGAAGTTCATGAGAATGTTACTCTGCACTGTGGCAACATCTCGGGACTGAGGGGCCAGGTGACCTGG
 ::.:::::::::.::::::.::::::::::: ::::::::.:: :::: :::::::::::::::.::::.::::::::  :::::::::
GGACTGGAGGCTGCTGTCATCGGAGAAGTTCAAGAGAATGTCACGCTGCTCTGTGGCAACATCTCAGGACCGAGGGGCCTCGTGACCTGG
-G--L--E--A--A--V--I--G--E--V--Q--E--N--V--T--L--L--C--G--N--I--S--G--P--R--G--L--V--T--W-

-Y--R--N--N--S--E--P--V--F--L--L--S--S--N--S--S--L--R--P--A--E--P--R--F--S--L--V--D--A--T-
TACCGGAACAACTCGGAGCCTGTCTTCCTTCTCTCGTCCAACTCTAGCCTCCGGCCAGCTGAGCCTCGCTTCTCTCTAGTGGATGCCACC
::.:::::..:::::::::::::::::::. : :: :::::.::.::.:: : :.::::. :::: ::::::: :::.:::.:::::: :
TATCGGAATGACTCGGAGCCTGTCTTCCTCGTGTCCTCCAATTCCAGTCTGCCGTCAGCCCAGCCACGCTTCTGTCTGGTGAATGCCAGC
-Y--R--N--D--S--E--P--V--F--L--V--S--S--N--S--S--L--P--S--A--Q--P--R--F--C--L--V--N--A--S-

-S--L--H--I--E--S--L--S--L--G--D--E--G--I--Y--T--C--Q--E--I--L--N--V--T--Q--W--F--Q--V--W-
TCCCTGCACATTGAATCGCTGAGCCTGGGAGATGAGGGAATCTACACCTGCCAGGAGATCCTGAATGTGACTCAGTGGTTCCAAGTGTGG
::::::::::::::. :.::::::::: ..::::::::.: ::::::::::..::::.:::::::.: :::::.::::::::::::::::
TCCCTGCACATTGAGGCACTGAGCCTGCAGGATGAGGGGAACTACACCTGCTGGGAGGTCCTGAACGAGACTCGGTGGTTCCAAGTGTGG
-S--L--H--I--E--A--L--S--L--Q--D--E--G--N--Y--T--C--W--E--V--L--N--E--T--R--W--F--Q--V--W-

-L--Q--V--A--
CTGCAGGTGGCCA
:::::::::::: 
CTGCAGGTGGCC 
-L--Q--V--A--

BGISUSX0000141490 all Identity : 78.723%

-G--L--E--A--V--V--I--G--E--V--H--E--N--V--T--L--H--C--G--N--I--S--G--L--R--G--Q--V--T--W-
-GATTGGAGGCTGTTGTCATTGGAGAAGTTCATGAGAATGTTACTCTGCACTGTGGCAACATCTCGGGACTGAGGGGCCAGGTGACCTGG
 ::.:::::::::.::::::.::::::::::: ::::::::.:: :::: :::::::::::::::.::::.::::::::  :::::::::
GGACTGGAGGCTGCTGTCATCGGAGAAGTTCAAGAGAATGTCACGCTGCTCTGTGGCAACATCTCAGGACCGAGGGGCCTCGTGACCTGG
-G--L--E--A--A--V--I--G--E--V--Q--E--N--V--T--L--L--C--G--N--I--S--G--P--R--G--L--V--T--W-

-Y--R--N--N--S--E--P--V--F--L--L--S--S--N--S--S--L--R--P--A--E--P--R--F--S--L--V--D--A--T-
TACCGGAACAACTCGGAGCCTGTCTTCCTTCTCTCGTCCAACTCTAGCCTCCGGCCAGCTGAGCCTCGCTTCTCTCTAGTGGATGCCACC
::.:::::..:::::::::::::::::::. : :: :::::.::.::.:: : :.::::. :::: ::::::: :::.:::.:::::: :
TATCGGAATGACTCGGAGCCTGTCTTCCTCGTGTCCTCCAATTCCAGTCTGCCGTCAGCCCAGCCACGCTTCTGTCTGGTGAATGCCAGC
-Y--R--N--D--S--E--P--V--F--L--V--S--S--N--S--S--L--P--S--A--Q--P--R--F--C--L--V--N--A--S-

-S--L--H--I--E--S--L--S--L--G--D--E--G--I--Y--T--C--Q--E--I--L--N--V--T--Q--W--F--Q--V--W-
TCCCTGCACATTGAATCGCTGAGCCTGGGAGATGAGGGAATCTACACCTGCCAGGAGATCCTGAATGTGACTCAGTGGTTCCAAGTGTGG
::::::::::::::. :.::::::::: ..::::::::.: ::::::::::..::::.:::::::.: :::::.::::::::::::::::
TCCCTGCACATTGAGGCACTGAGCCTGCAGGATGAGGGGAACTACACCTGCTGGGAGGTCCTGAACGAGACTCGGTGGTTCCAAGTGTGG
-S--L--H--I--E--A--L--S--L--Q--D--E--G--N--Y--T--C--W--E--V--L--N--E--T--R--W--F--Q--V--W-

-L--Q--V--A--
CTGCAGGTGGCCA
:::::::::::: 
CTGCAGGTGGCC 
-L--Q--V--A--