Exon Sequence
>ENSE00001311670 NT
CCCCCTCCATCAGCTCCCCA
GTGCTGGGCACAGATGGCAT
CAGGATCGTTCATGTTGCAG
CTTACCTGTCGCTGGGATGG
GGGATACCCTGACCCTGACT
TCCTGTGGATAGAAGAGCCA
GGAGGTGTAATCGTGGGGAA
GTCAAAGCTGGGGGTGGAAA
TGCTGAGCGAGTCCCAGCTG
TCGGATGGCAAGAAGTTCAA
GTGTGTTACAAGCCACATAG
TTGGGCCAGAGTCGGGCGCC
AGCTGCATGGTGCAGATC
>ENSE00001311670 AA
-PPPSAPQCWAQMASGSFML
QLTCRWDGGYPDPDFLWIEE
PGGVIVGKSKLGVEMLSESQ
LSDGKKFKCVTSHIVGPESG
ASCMVQI

ENSE00001311670

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100