Exon Sequence
>ENSE00001311879 NT
GGAATGGAATCTCAACCTTT
CCTGAATATGAAATTTGAAA
CGGATTATTTCGTAAAGGTT
GTCCCTTTTCCTTCCATTAA
AAACGAAAGCAATTACCACC
CTTTCTTCTTTAGAACCCGA
>ENSE00001311879 AA
GMESQPFLNMKFETDYFVKV
VPFPSIKNESNYHPFFFRTR

ENSE00001311879

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0000133367 all Identity : 97.436%

-G--M--E--S--Q--P--F--L--N--M--K--F--E--T--D--Y--F--V--K--V--V--P--F--P--S--I--K--N--E--S-
GGAATGGAATCTCAACCTTTCCTGAATATGAAATTTGAAACGGATTATTTCGTAAAGGTTGTCCCTTTTCCTTCCATTAAAAACGAAAGC
::::::::::::::.::::::::::::::::::::::::::.:::::.::.:: :::.::::::::::::::::::::::::::::::::
GGAATGGAATCTCAGCCTTTCCTGAATATGAAATTTGAAACAGATTACTTTGTCAAGATTGTCCCTTTTCCTTCCATTAAAAACGAAAGC
-G--M--E--S--Q--P--F--L--N--M--K--F--E--T--D--Y--F--V--K--I--V--P--F--P--S--I--K--N--E--S-

-N--Y--H--P--F--F--F--R--T--R--
AATTACCACCCTTTCTTCTTTAGAACCCGAG
:::::.:::::::::::::::::::::    
AATTATCACCCTTTCTTCTTTAGAACC    
-N--Y--H--P--F--F--F--R--T-----