Exon Sequence
>ENSE00001327359 NT
AGAAGACCCCCTGCTGCGCC
CAGCCGGCCCACCATTATCC
GCCCAGCCGAGCCATCCCTG
CTCGACTAG
>ENSE00001327359 AA
-RRPPAAPSRPTIIRPAEPS
LLD*

ENSE00001327359

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002097561 est Identity : 100%

-S--R--R--P--P--A--A--P--S--R--P--T--I--I--R--P--A--E--P--S--L--L--D--*-                  
--CAGAAGACCCCCTGCTGCGCCCAGCCGGCCCACCATTATCCGCCCAGCCGAGCCATCCCTGCTCGACTAGGCCTCGAGGGGGGCGTGC
  ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::                  
AGCAGAAGACCCCCTGCTGCGCCCAGCCGGCCCACCATTATCCGCCCAGCCGAGCCATCCCTGCTCGACTAG                  
-S--R--R--P--P--A--A--P--S--R--P--T--I--I--R--P--A--E--P--S--L--L--D--*-                  

                                                                                          
TCTCGGGGGGGCCTCACGCACCCGCGGCGCAGGAGCTTCAGTGGTCTGGGGCCCTCCGCCGCCCCTATGCTGGGACCAGGCTCCCAGTGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCAGCCCTGGCCTCTTCCTTAACGCTGGCCCCGGTCCAGGGCCGGCCCCTGTGCCTGGCTGGACACCGCACTGCGCAAAGGGGCCCTGGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCTCCAGGCAGGGGGCGCTGGGGTGTTGCACTTTGGGGGATGGAGTCTCAGGGTGGCAGAGGGGGGACCAGAACCCTTGACACCATCCTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AATGAGGGGTCCAGCCTGGGGGGGACTCTACCAAGGTCTTCTTGGGCTGGGAAAGCCCATGTAGGGCAGGCCTTCTATAAGTGCGGGCAC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAAGGGCGCCTACATCCCCAGGCCTTGCTGGGGTGCAGGGGTATATCAACTTCCCATTAGCAGGAGCTCCCCAGCGGCAAGCCTGGCCCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTGGGCTCGGTAGTGCCCAGCTGGCAGGCCTGAGGTGTACATAGTCCTTCCCGGCCATATTAACCACACAGCCTGAGCCTGGCCCAGCCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CGGCTGCCAGAGGTGCCTTTGCTAGGCCCGGAGCCGTTGGCCCGGGCCGGCCTTGCCCTATTCCTCTCCTCCTCCTCCTCCTGGGTCCCC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAGGGTGGCTGGGCTTGGGCTATGTGGGTGGTGGTGGCGGGGGGTCTTGGGGGCCTCTCAGCTCCCGCCCATGCCTCCCTGATGGGTGGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCCAGGGCGGCCTCTCTCTGAGGAGACCTCACCCACTCCTCGCTCAGTTTGACCACTGTAAGTGCCTGCACTCTGTATTCTATTAATAAA
                                                                                          
                                                                                          
                                                                                          

                            
CTAAAATAAAGGGAAGACGCTGCTGGTG
                            
                            
                            

BGISUSX0001064367 both Identity : 100%

-S--R--R--P--P--A--A--P--S--R--P--T--I--I--R--P--A--E--P--S--L--L--D--*-                  
--CAGAAGACCCCCTGCTGCGCCCAGCCGGCCCACCATTATCCGCCCAGCCGAGCCATCCCTGCTCGACTAGGCCTCGAGGGGGGCGTGC
  ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::                  
AGCAGAAGACCCCCTGCTGCGCCCAGCCGGCCCACCATTATCCGCCCAGCCGAGCCATCCCTGCTCGACTAG                  
-S--R--R--P--P--A--A--P--S--R--P--T--I--I--R--P--A--E--P--S--L--L--D--*-                  

                                                                                          
TCTCGGGGGGGCCTCACGCACCCGCGGCGCAGGAGCTTCAGTGGTCTGGGGCCCTCCGCCGCCCCTATGCTGGGACCAGGCTCCCAGTGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCAGCCCTGGCCTCTTCCTTAACGCTGGCCCCGGTCCAGGGCCGGCCCCTGTGCCTGGCTGGACACCGCACTGCGCAAAGGGGCCCTGGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCTCCAGGCAGGGGGCGCTGGGGTGTTGCACTTTGGGGGATGGAGTCTCAGGGTGGCAGAGGGGGGACCAGAACCCTTGACACCATCCTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AATGAGGGGTCCAGCCTGGGGGGGACTCTACCAAGGTCTTCTTGGGCTGGGAAAGCCCATGTAGGGCAGGCCTTCTATAAGTGCGGGCAC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAAGGGCGCCTACATCCCCAGGCCTTGCTGGGGTGCAGGGGTATATCAACTTCCCATTAGCAGGAGCTCCCCAGCGGCAAGCCTGGCCCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTGGGCTCGGTAGTGCCCAGCTGGCAGGCCTGAGGTGTACATAGTCCTTCCCGGCCATATTAACCACACAGCCTGAGCCTGGCCCAGCCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CGGCTGCCAGAGGTGCCTTTGCTAGGCCCGGAGCCGTTGGCCCGGGCCGGCCTTGCCCTATTCCTCTCCTCCTCCTCCTCCTGGGTCCCC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAGGGTGGCTGGGCTTGGGCTATGTGGGTGGTGGTGGCGGGGGGTCTTGGGGGCCTCTCAGCTCCCGCCCATGCCTCCCTGATGGGTGGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCCAGGGCGGCCTCTCTCTGAGGAGACCTCACCCACTCCTCGCTCAGTTTGACCACTGTAAGTGCCTGCACTCTGTATTCTATTAATAAA
                                                                                          
                                                                                          
                                                                                          

                            
CTAAAATAAAGGGAAGACGCTGCTGGTG
                            
                            
                            

BGISUSX0000082624 all Identity : 100%

-S--R--R--P--P--A--A--P--S--R--P--T--I--I--R--P--A--E--P--S--L--L--D--*-                  
--CAGAAGACCCCCTGCTGCGCCCAGCCGGCCCACCATTATCCGCCCAGCCGAGCCATCCCTGCTCGACTAGGCCTCGAGGGGGGCGTGC
  ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::                  
AGCAGAAGACCCCCTGCTGCGCCCAGCCGGCCCACCATTATCCGCCCAGCCGAGCCATCCCTGCTCGACTAG                  
-S--R--R--P--P--A--A--P--S--R--P--T--I--I--R--P--A--E--P--S--L--L--D--*-                  

                                                                                          
TCTCGGGGGGGCCTCACGCACCCGCGGCGCAGGAGCTTCAGTGGTCTGGGGCCCTCCGCCGCCCCTATGCTGGGACCAGGCTCCCAGTGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCAGCCCTGGCCTCTTCCTTAACGCTGGCCCCGGTCCAGGGCCGGCCCCTGTGCCTGGCTGGACACCGCACTGCGCAAAGGGGCCCTGGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCTCCAGGCAGGGGGCGCTGGGGTGTTGCACTTTGGGGGATGGAGTCTCAGGGTGGCAGAGGGGGGACCAGAACCCTTGACACCATCCTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AATGAGGGGTCCAGCCTGGGGGGGACTCTACCAAGGTCTTCTTGGGCTGGGAAAGCCCATGTAGGGCAGGCCTTCTATAAGTGCGGGCAC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAAGGGCGCCTACATCCCCAGGCCTTGCTGGGGTGCAGGGGTATATCAACTTCCCATTAGCAGGAGCTCCCCAGCGGCAAGCCTGGCCCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTGGGCTCGGTAGTGCCCAGCTGGCAGGCCTGAGGTGTACATAGTCCTTCCCGGCCATATTAACCACACAGCCTGAGCCTGGCCCAGCCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CGGCTGCCAGAGGTGCCTTTGCTAGGCCCGGAGCCGTTGGCCCGGGCCGGCCTTGCCCTATTCCTCTCCTCCTCCTCCTCCTGGGTCCCC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAGGGTGGCTGGGCTTGGGCTATGTGGGTGGTGGTGGCGGGGGGTCTTGGGGGCCTCTCAGCTCCCGCCCATGCCTCCCTGATGGGTGGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCCAGGGCGGCCTCTCTCTGAGGAGACCTCACCCACTCCTCGCTCAGTTTGACCACTGTAAGTGCCTGCACTCTGTATTCTATTAATAAA
                                                                                          
                                                                                          
                                                                                          

                            
CTAAAATAAAGGGAAGACGCTGCTGGTG
                            
                            
                            

BGISUSX0002097561 est Identity : 66.667%

----R--R--P--P--A--A--P--S--R--P--T--I--I--R--P--A--E--P--S--L--L--D--*-                  
--CAGAAGACCCCCTGCTGCGCCCAGCCGGCCCACCATTATCCGCCCAGCCGAGCCATCCCTGCTCGACTAGGCCTCGAGGGGGGCGTGC
            :: :::: :: :::: ::                                                            
            CCGGCTGGGCGCAGCAGG                                                            
-------------P--A--G--R--S--R-------------------------------------------                  

                                                                                          
TCTCGGGGGGGCCTCACGCACCCGCGGCGCAGGAGCTTCAGTGGTCTGGGGCCCTCCGCCGCCCCTATGCTGGGACCAGGCTCCCAGTGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCAGCCCTGGCCTCTTCCTTAACGCTGGCCCCGGTCCAGGGCCGGCCCCTGTGCCTGGCTGGACACCGCACTGCGCAAAGGGGCCCTGGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCTCCAGGCAGGGGGCGCTGGGGTGTTGCACTTTGGGGGATGGAGTCTCAGGGTGGCAGAGGGGGGACCAGAACCCTTGACACCATCCTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AATGAGGGGTCCAGCCTGGGGGGGACTCTACCAAGGTCTTCTTGGGCTGGGAAAGCCCATGTAGGGCAGGCCTTCTATAAGTGCGGGCAC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAAGGGCGCCTACATCCCCAGGCCTTGCTGGGGTGCAGGGGTATATCAACTTCCCATTAGCAGGAGCTCCCCAGCGGCAAGCCTGGCCCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTGGGCTCGGTAGTGCCCAGCTGGCAGGCCTGAGGTGTACATAGTCCTTCCCGGCCATATTAACCACACAGCCTGAGCCTGGCCCAGCCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CGGCTGCCAGAGGTGCCTTTGCTAGGCCCGGAGCCGTTGGCCCGGGCCGGCCTTGCCCTATTCCTCTCCTCCTCCTCCTCCTGGGTCCCC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAGGGTGGCTGGGCTTGGGCTATGTGGGTGGTGGTGGCGGGGGGTCTTGGGGGCCTCTCAGCTCCCGCCCATGCCTCCCTGATGGGTGGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCCAGGGCGGCCTCTCTCTGAGGAGACCTCACCCACTCCTCGCTCAGTTTGACCACTGTAAGTGCCTGCACTCTGTATTCTATTAATAAA
                                                                                          
                                                                                          
                                                                                          

                            
CTAAAATAAAGGGAAGACGCTGCTGGTG
                            
                            
                            

BGISUSX0001064367 both Identity : 66.667%

----R--R--P--P--A--A--P--S--R--P--T--I--I--R--P--A--E--P--S--L--L--D--*-                  
--CAGAAGACCCCCTGCTGCGCCCAGCCGGCCCACCATTATCCGCCCAGCCGAGCCATCCCTGCTCGACTAGGCCTCGAGGGGGGCGTGC
            :: :::: :: :::: ::                                                            
            CCGGCTGGGCGCAGCAGG                                                            
-------------P--A--G--R--S--R-------------------------------------------                  

                                                                                          
TCTCGGGGGGGCCTCACGCACCCGCGGCGCAGGAGCTTCAGTGGTCTGGGGCCCTCCGCCGCCCCTATGCTGGGACCAGGCTCCCAGTGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCAGCCCTGGCCTCTTCCTTAACGCTGGCCCCGGTCCAGGGCCGGCCCCTGTGCCTGGCTGGACACCGCACTGCGCAAAGGGGCCCTGGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCTCCAGGCAGGGGGCGCTGGGGTGTTGCACTTTGGGGGATGGAGTCTCAGGGTGGCAGAGGGGGGACCAGAACCCTTGACACCATCCTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AATGAGGGGTCCAGCCTGGGGGGGACTCTACCAAGGTCTTCTTGGGCTGGGAAAGCCCATGTAGGGCAGGCCTTCTATAAGTGCGGGCAC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAAGGGCGCCTACATCCCCAGGCCTTGCTGGGGTGCAGGGGTATATCAACTTCCCATTAGCAGGAGCTCCCCAGCGGCAAGCCTGGCCCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTGGGCTCGGTAGTGCCCAGCTGGCAGGCCTGAGGTGTACATAGTCCTTCCCGGCCATATTAACCACACAGCCTGAGCCTGGCCCAGCCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CGGCTGCCAGAGGTGCCTTTGCTAGGCCCGGAGCCGTTGGCCCGGGCCGGCCTTGCCCTATTCCTCTCCTCCTCCTCCTCCTGGGTCCCC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAGGGTGGCTGGGCTTGGGCTATGTGGGTGGTGGTGGCGGGGGGTCTTGGGGGCCTCTCAGCTCCCGCCCATGCCTCCCTGATGGGTGGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCCAGGGCGGCCTCTCTCTGAGGAGACCTCACCCACTCCTCGCTCAGTTTGACCACTGTAAGTGCCTGCACTCTGTATTCTATTAATAAA
                                                                                          
                                                                                          
                                                                                          

                            
CTAAAATAAAGGGAAGACGCTGCTGGTG
                            
                            
                            

BGISUSX0000082624 all Identity : 66.667%

----R--R--P--P--A--A--P--S--R--P--T--I--I--R--P--A--E--P--S--L--L--D--*-                  
--CAGAAGACCCCCTGCTGCGCCCAGCCGGCCCACCATTATCCGCCCAGCCGAGCCATCCCTGCTCGACTAGGCCTCGAGGGGGGCGTGC
            :: :::: :: :::: ::                                                            
            CCGGCTGGGCGCAGCAGG                                                            
-------------P--A--G--R--S--R-------------------------------------------                  

                                                                                          
TCTCGGGGGGGCCTCACGCACCCGCGGCGCAGGAGCTTCAGTGGTCTGGGGCCCTCCGCCGCCCCTATGCTGGGACCAGGCTCCCAGTGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCAGCCCTGGCCTCTTCCTTAACGCTGGCCCCGGTCCAGGGCCGGCCCCTGTGCCTGGCTGGACACCGCACTGCGCAAAGGGGCCCTGGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCTCCAGGCAGGGGGCGCTGGGGTGTTGCACTTTGGGGGATGGAGTCTCAGGGTGGCAGAGGGGGGACCAGAACCCTTGACACCATCCTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AATGAGGGGTCCAGCCTGGGGGGGACTCTACCAAGGTCTTCTTGGGCTGGGAAAGCCCATGTAGGGCAGGCCTTCTATAAGTGCGGGCAC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAAGGGCGCCTACATCCCCAGGCCTTGCTGGGGTGCAGGGGTATATCAACTTCCCATTAGCAGGAGCTCCCCAGCGGCAAGCCTGGCCCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTGGGCTCGGTAGTGCCCAGCTGGCAGGCCTGAGGTGTACATAGTCCTTCCCGGCCATATTAACCACACAGCCTGAGCCTGGCCCAGCCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CGGCTGCCAGAGGTGCCTTTGCTAGGCCCGGAGCCGTTGGCCCGGGCCGGCCTTGCCCTATTCCTCTCCTCCTCCTCCTCCTGGGTCCCC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAGGGTGGCTGGGCTTGGGCTATGTGGGTGGTGGTGGCGGGGGGTCTTGGGGGCCTCTCAGCTCCCGCCCATGCCTCCCTGATGGGTGGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCCAGGGCGGCCTCTCTCTGAGGAGACCTCACCCACTCCTCGCTCAGTTTGACCACTGTAAGTGCCTGCACTCTGTATTCTATTAATAAA
                                                                                          
                                                                                          
                                                                                          

                            
CTAAAATAAAGGGAAGACGCTGCTGGTG