Exon Sequence
>ENSE00001327481 NT
GAGTCAGTGCTGATGGACCT
CAAAGCGCTGCTGCTAGAAG
CCAAGCAGAAGGTGCCGCCC
GTGCTGCAGGTGCTGCATTG
CGGGGATGAGTCCATGCTGG
ACATTGGA
>ENSE00001327481 AA
-ESVLMDLKALLLEAKQKVP
PVLQVLHCGDESMLDIG

ENSE00001327481

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002030897 est Identity : 100%

-D--E--S--V--L--M--D--L--K--A--L--L--L--E--A--K--Q--K--V--P--P--V--L--Q--V--L--H--C--G--D-
-ATGAGTCAGTGCTGATGGACCTCAAAGCGCTGCTGCTAGAAGCCAAGCAGAAGGTGCCGCCCGTGCTGCAGGTGCTGCATTGCGGGGAT
 :::::::::::::::::::::::::::: ::::::::.::.:::::::::::.:: ::.::.::::::::.:::::.::.::.::.::.
GATGAGTCAGTGCTGATGGACCTCAAAGCCCTGCTGCTGGAGGCCAAGCAGAAAGTTCCACCTGTGCTGCAAGTGCTACACTGTGGAGAC
-D--E--S--V--L--M--D--L--K--A--L--L--L--E--A--K--Q--K--V--P--P--V--L--Q--V--L--H--C--G--D-

-E--S--M--L--D--I--G--
GAGTCCATGCTGGACATTGGAG
::::::::::::::::::::: 
GAGTCCATGCTGGACATTGGA 
-E--S--M--L--D--I--G--

BGISUSX0001020595 both Identity : 100%

-D--E--S--V--L--M--D--L--K--A--L--L--L--E--A--K--Q--K--V--P--P--V--L--Q--V--L--H--C--G--D-
-ATGAGTCAGTGCTGATGGACCTCAAAGCGCTGCTGCTAGAAGCCAAGCAGAAGGTGCCGCCCGTGCTGCAGGTGCTGCATTGCGGGGAT
 :::::::::::::::::::::::::::: ::::::::.::.:::::::::::.:: ::.::.::::::::.:::::.::.::.::.::.
GATGAGTCAGTGCTGATGGACCTCAAAGCCCTGCTGCTGGAGGCCAAGCAGAAAGTTCCACCTGTGCTGCAAGTGCTACACTGTGGAGAC
-D--E--S--V--L--M--D--L--K--A--L--L--L--E--A--K--Q--K--V--P--P--V--L--Q--V--L--H--C--G--D-

-E--S--M--L--D--I--G--
GAGTCCATGCTGGACATTGGAG
::::::::::::::::::::: 
GAGTCCATGCTGGACATTGGA 
-E--S--M--L--D--I--G--

BGISUSX0000027079 all Identity : 100%

-D--E--S--V--L--M--D--L--K--A--L--L--L--E--A--K--Q--K--V--P--P--V--L--Q--V--L--H--C--G--D-
-ATGAGTCAGTGCTGATGGACCTCAAAGCGCTGCTGCTAGAAGCCAAGCAGAAGGTGCCGCCCGTGCTGCAGGTGCTGCATTGCGGGGAT
 :::::::::::::::::::::::::::: ::::::::.::.:::::::::::.:: ::.::.::::::::.:::::.::.::.::.::.
GATGAGTCAGTGCTGATGGACCTCAAAGCCCTGCTGCTGGAGGCCAAGCAGAAAGTTCCACCTGTGCTGCAAGTGCTACACTGTGGAGAC
-D--E--S--V--L--M--D--L--K--A--L--L--L--E--A--K--Q--K--V--P--P--V--L--Q--V--L--H--C--G--D-

-E--S--M--L--D--I--G--
GAGTCCATGCTGGACATTGGAG
::::::::::::::::::::: 
GAGTCCATGCTGGACATTGGA 
-E--S--M--L--D--I--G--