Exon Sequence
>ENSE00001368896 NT
CCTAAACGGCAGCGGCAAAA
CAACTTTCCCATGTTTCCCT
CTCCTAAAGCCTGGAATTTC
AGAGGG
>ENSE00001368896 AA
-PKRQRQNNFPMFPSPKAWN
FRG

ENSE00001368896

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003059707 reads Identity : 100%

-R--P--K--R--Q--R--Q--N--N--F--P--M--F--P--S--P--K--A--W--N--F--R--G-
--GCCTAAACGGCAGCGGCAAAACAACTTTCCCATGTTTCCCTCTCCTAAAGCCTGGAATTTCAGAGGG
  ::::::::::::::::::::::::::::::::::::::: :::::::::::::::::::::::::::
AGGCCTAAACGGCAGCGGCAAAACAACTTTCCCATGTTTCCATCTCCTAAAGCCTGGAATTTCAGAGGG
-R--P--K--R--Q--R--Q--N--N--F--P--M--F--P--S--P--K--A--W--N--F--R--G-

BGISUSX0001138555 both Identity : 100%

-R--P--K--R--Q--R--Q--N--N--F--P--M--F--P--S--P--K--A--W--N--F--R--G-
--GCCTAAACGGCAGCGGCAAAACAACTTTCCCATGTTTCCCTCTCCTAAAGCCTGGAATTTCAGAGGG
  ::::::::::::::::::::::::::::::::::::::: :::::::::::::::::::::::::::
AGGCCTAAACGGCAGCGGCAAAACAACTTTCCCATGTTTCCATCTCCTAAAGCCTGGAATTTCAGAGGG
-R--P--K--R--Q--R--Q--N--N--F--P--M--F--P--S--P--K--A--W--N--F--R--G-

BGISUSX0000179910 all Identity : 100%

-R--P--K--R--Q--R--Q--N--N--F--P--M--F--P--S--P--K--A--W--N--F--R--G-
--GCCTAAACGGCAGCGGCAAAACAACTTTCCCATGTTTCCCTCTCCTAAAGCCTGGAATTTCAGAGGG
  ::::::::::::::::::::::::::::::::::::::: :::::::::::::::::::::::::::
AGGCCTAAACGGCAGCGGCAAAACAACTTTCCCATGTTTCCATCTCCTAAAGCCTGGAATTTCAGAGGG
-R--P--K--R--Q--R--Q--N--N--F--P--M--F--P--S--P--K--A--W--N--F--R--G-

BGISUSX0000179911 all Identity : 100%

-R--P--K--R--Q--R--Q--N--N--F--P--M--F--P--S--P--K--A--W--N--F--R--G-
--GCCTAAACGGCAGCGGCAAAACAACTTTCCCATGTTTCCCTCTCCTAAAGCCTGGAATTTCAGAGGG
  ::::::::::::::::::::::::::::::::::::::: :::::::::::::::::::::::::::
AGGCCTAAACGGCAGCGGCAAAACAACTTTCCCATGTTTCCATCTCCTAAAGCCTGGAATTTCAGAGGG
-R--P--K--R--Q--R--Q--N--N--F--P--M--F--P--S--P--K--A--W--N--F--R--G-