Exon Sequence
>ENSE00001375265 NT
ATGGGCGCCAAACAGAGCGG
CCCGGCCGCCGCTAACGGCC
GCACGCGCGCGTACTCGGGC
TCGGATCTACCTTCCAGTAG
CAGCGGAGGCGCCAATGGGA
CCGCGGGCGGCGGCGGGGGC
GCTCGGGCCGCCGCCGCGGG
GAGGTTCCCGGCTCAGGTGC
CCAGCGCGCACCAGCCCAGC
GCCTCCGGCGGCGCCGCGGC
GGCCGCGGCGGCCCCGGCAG
CCCCGGCGGCCCCGCGCAGC
CGCTCCCTCGGCGGGGCCGT
GGGGAGCGTGGCGTCGGGGG
CCCGCGCGGCGCAGTCCCCC
TTCAGCATCCCGAACAGCAG
CAGCGGCCCGTACGGCTCGC
AGGACTCGGTGCACAGCAGC
CCTGAGGACGGCGGCGGCGG
CCGGGACCGGCCGGTGGGCG
GGAGCCCCGGCGGGCCGCGC
CTGGTGATCGGCTCCTTACC
AGCTCACCTCTCGCCGCACA
TGTTTGGA
>ENSE00001375265 AA
MGAKQSGPAAANGRTRAYSG
SDLPSSSSGGANGTAGGGGG
ARAAAAGRFPAQVPSAHQPS
ASGGAAAAAAAPAAPAAPRS
RSLGGAVGSVASGARAAQSP
FSIPNSSSGPYGSQDSVHSS
PEDGGGGRDRPVGGSPGGPR
LVIGSLPAHLSPHMFG

ENSE00001375265

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0002038897 est Identity : 88.406%

                                                                                          
GCGGGCCACGTGCGGGAGGAGGGGCCGCCTTCTGGTTGGCGCCCGGTGTCCGTTCCTCCTATCGGCGTAGGCCCCGCGAGGAAGACAAGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCGCGCCCTGGCTGGGAGGGCGTGGCCAGAGACCTGTCCATCACCGAGTCCACGAGTGGCAGCACCTACCACACCGCAGTACCTTGGCGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGCGGAGCAGGGGCAGGCAGGTCGCGGAAGGGGGAGGCGGAGCAAGGCCGGCGGGAGCCAATCGGCCTGGCGGCACGAGGGGGCGGGGGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGGGTCAACGCGCGCGACCCAAACACACGGGCCGGGCGCACCCTGCAGCCGCGCCGCTCCGCGGCCTTCCGGCGCGGGGCCGGGGAACCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCTCCCCATCTGCGCACCCCCCGCCTTCGCGGCCCAGATCCTCCCGCCAGCCCGGCCCCTCCTTCGCAGGGGGAGCGAGGCGACGGTTGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CGGGAAGCGCGCGCCACCTCTCCCTCCCATTTTTCGTTCTCCCCTCGCGCGCCACCCGTTTTTCCTCTTTCTCCGTTAATAACAGCTGGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TGGCTGGGGGAGGAGGGAAGGTGGCCCCGGCGGAGTCTGGGCGGGCGCCTCCCACTCAGCCGCCAGCCGCCGTGGGAGCCGGAGGATGGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGCGGTAGCAGCGGCCGCCCGAGAGGAGGCGGTGCCGAGATCGGGGGCGCCGAGCGCGGCAGCAGAGAGCGGTAGCGGCCCGTCGTGGCG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CACCAGAACCGAAACCAGCGGCAGCCGCACGGCCACTTGAGCCGCCCCTTCCTGCTGGAGCCAGCGAGGGGTGCCTGCAGCCGGGACCCC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTCCTCTCCGCGTCTCCTCGTCTCCCGCGCCCGCGTCAGGCCGTCGGCCTCGCCCGCCGCCCCAAGAAGAGCGCGCCGGGCGCCGACTGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCCTCTGGACGCCGGGCGGCGGCCCTGGACGTGCGGGGGCCTCTCTGGGCCGGCCGCGGCGCCTGGGCCCTGCCCTCTAGCTCCCGCGCT
                                                                                          
                                                                                          
                                                                                          

                                                             -M--G--A--K--Q--S--G--P--A--A
CGCTCCCGCCCTCCCGGCTCTCGGGGCGCAGCGCGCGGGCCCGGCCCGGGGCAGGGCGGACATGGGCGCCAAACAGAGCGGCCCGGCCGC
                                                                                          
                                                                                          
                                                             -----------------------------

--A--N--G--R--T--R--A--Y--S--G--S--D--L--P--S--S--S--S--G--G--A--N--G--T--A--G--G--G--G--G
CGCTAACGGCCGCACGCGCGCGTACTCGGGCTCGGATCTACCTTCCAGTAGCAGCGGAGGCGCCAATGGGACCGCGGGCGGCGGCGGGGG
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

--A--R--A--A--A--A--G--R--F--P--A--Q--V--P--S--A--H--Q--P--S--A--S--G--G--A--A--A--A--A--A
CGCTCGGGCCGCCGCCGCGGGGAGGTTCCCGGCTCAGGTGCCCAGCGCGCACCAGCCCAGCGCCTCCGGCGGCGCCGCGGCGGCCGCGGC
                                                                                          
                                                                                          
------------------------------------------------------------------------------------------

--A--P--A--A--P--A--A--P--R--S--R--S--L--G--G--A--V--G--S--V--A--S--G--A--R--A--A--Q--S--P
GGCCCCGGCAGCCCCGGCGGCCCCGCGCAGCCGCTCCCTCGGCGGGGCCGTGGGGAGCGTGGCGTCGGGGGCCCGCGCGGCGCAGTCCCC
                                                                   ::::::::::::::::::::: :
                                                                   GGGGCCCGCGCGGCGCAGTCCAC
--------------------------------------------------------------------G--A--R--A--A--Q--S--T

--F--S--I--P--N--S--S--S--G--P--Y--G--S--Q--D--S--V--H--S--S--P--E--D--G--G--G--G---------
CTTCAGCATCCCGAACAGCAGCAGCGGCCCGTACGGCTCGCAGGACTCGGTGCACAGCAGCCCTGAGGACGGCGGCGGCGGC--------
:::::::::::: ::.::::::::::::::::::::::::::::::::::: ::::::::::: ::::::::::::::::::        
CTTCAGCATCCCCAATAGCAGCAGCGGCCCGTACGGCTCGCAGGACTCGGTTCACAGCAGCCCGGAGGACGGCGGCGGCGGCGGCAGCGG
--F--S--I--P--N--S--S--S--G--P--Y--G--S--Q--D--S--V--H--S--S--P--E--D--G--G--G--G--G--S--G

--------R--D--R--P--V--G--G--S--P--G--G--P--R--L--V--I--G--S--L--P--A--H--L--S--P--H--M--F
-------CGGGACCGGCCGGTGGGCGGGAGCCCCGGCGGGCCGCGCCTGGTGATCGGCTCCTTACCAGCTCACCTCTCGCCGCACATGTT
        ::::::::::::.:::::::.:::::::::::::::::::::::::::::::.:::::::::::::::::::::::::::::
CGGCGGCAGGGACCGGCCGGCGGGCGGGGGCCCCGGCGGGCCGCGCCTGGTGATCGGCTCTTTACCAGCTCACCTCTCGCCGCACATGTT
--G--G--R--D--R--P--A--G--G--G--P--G--G--P--R--L--V--I--G--S--L--P--A--H--L--S--P--H--M--F

--G--
TGGAG
:::: 
TGGA 
--G--

BGISUSX0003025297 reads Identity : 84.615%

                                                                                          
GCGGGCCACGTGCGGGAGGAGGGGCCGCCTTCTGGTTGGCGCCCGGTGTCCGTTCCTCCTATCGGCGTAGGCCCCGCGAGGAAGACAAGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCGCGCCCTGGCTGGGAGGGCGTGGCCAGAGACCTGTCCATCACCGAGTCCACGAGTGGCAGCACCTACCACACCGCAGTACCTTGGCGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGCGGAGCAGGGGCAGGCAGGTCGCGGAAGGGGGAGGCGGAGCAAGGCCGGCGGGAGCCAATCGGCCTGGCGGCACGAGGGGGCGGGGGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGGGTCAACGCGCGCGACCCAAACACACGGGCCGGGCGCACCCTGCAGCCGCGCCGCTCCGCGGCCTTCCGGCGCGGGGCCGGGGAACCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCTCCCCATCTGCGCACCCCCCGCCTTCGCGGCCCAGATCCTCCCGCCAGCCCGGCCCCTCCTTCGCAGGGGGAGCGAGGCGACGGTTGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CGGGAAGCGCGCGCCACCTCTCCCTCCCATTTTTCGTTCTCCCCTCGCGCGCCACCCGTTTTTCCTCTTTCTCCGTTAATAACAGCTGGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TGGCTGGGGGAGGAGGGAAGGTGGCCCCGGCGGAGTCTGGGCGGGCGCCTCCCACTCAGCCGCCAGCCGCCGTGGGAGCCGGAGGATGGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGCGGTAGCAGCGGCCGCCCGAGAGGAGGCGGTGCCGAGATCGGGGGCGCCGAGCGCGGCAGCAGAGAGCGGTAGCGGCCCGTCGTGGCG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CACCAGAACCGAAACCAGCGGCAGCCGCACGGCCACTTGAGCCGCCCCTTCCTGCTGGAGCCAGCGAGGGGTGCCTGCAGCCGGGACCCC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTCCTCTCCGCGTCTCCTCGTCTCCCGCGCCCGCGTCAGGCCGTCGGCCTCGCCCGCCGCCCCAAGAAGAGCGCGCCGGGCGCCGACTGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCCTCTGGACGCCGGGCGGCGGCCCTGGACGTGCGGGGGCCTCTCTGGGCCGGCCGCGGCGCCTGGGCCCTGCCCTCTAGCTCCCGCGCT
                                                                                          
                                                                                          
                                                                                          

                                                             -M--G--A--K--Q--S--G--P--A--A
CGCTCCCGCCCTCCCGGCTCTCGGGGCGCAGCGCGCGGGCCCGGCCCGGGGCAGGGCGGACATGGGCGCCAAACAGAGCGGCCCGGCCGC
                                                                                          
                                                                                          
                                                             -----------------------------

--A--N--G--R--T--R--A--Y--S--G--S--D--L--P--S--S--S--S--------G--G--A--N--G--T--A--G--G--G
CGCTAACGGCCGCACGCGCGCGTACTCGGGCTCGGATCTACCTTCCAGTAGCAGC------GGAGGCGCCAATGGGACCGCGGGCGGCGG
                   ::::::::::::::::::.::::::::::.::::::      ::::: :::::.::::::::.      ::
                   GCGTACTCGGGCTCGGATTTACCTTCCAGCAGCAGCAGCAGCGGAGGGGCCAACGGGACCGCA------GG
--------------------A--Y--S--G--S--D--L--P--S--S--S--S--S--S--G--G--A--N--G--T--A--------G

--G--G--A--R--A--A--A--A--G--R--F--P--A--Q--V--P--S--A--H--Q--P--S--A--S--G--G--A--A--A--A
CGGGGGCGCTCGGGCCGCCGCCGCGGGGAGGTTCCCGGCTCAGGTGCCCAGCGCGCACCAGCCCAGCGCCTCCGGCGGCGCCGCGGCGGC
:.: :: :: :::::::: ::::: :::::.:: :::::::::::::::.:::::::::::::.::::::::::::::::::::::::::
CAGCGGGGCGCGGGCCGCGGCCGCCGGGAGATTGCCGGCTCAGGTGCCCGGCGCGCACCAGCCTAGCGCCTCCGGCGGCGCCGCGGCGGC
--S--G--A--R--A--A--A--A--G--R--L--P--A--Q--V--P--G--A--H--Q--P--S--A--S--G--G--A--A--A--A

--A--A--A--P--A--A--P--A--A--P--R--S--R--S--L--G--G--A--V--G--S--V--A--S--G--A--R--A--A--Q
CGCGGCGGCCCCGGCAGCCCCGGCGGCCCCGCGCAGCCGCTCCCTCGGCGGGGCCGTGGGGAGCGTGGCGTCGGGGGCCCGCGCGGCGCA
: ::                  :::::::::::::::::::::::::::::::: :::::.: :::::::::::::::::::::::::::
CTCG------------------GCGGCCCCGCGCAGCCGCTCCCTCGGCGGGGCGGTGGGAACCGTGGCGTCGGGGGCCCGCGCGGCGCA
--S--------------------A--A--P--R--S--R--S--L--G--G--A--V--G--T--V--A--S--G--A--R--A--A--Q

--S--P--F--S--I--P--N--S--S--S--G--P--Y--G--S--Q--D--S--V--H--S--S--P--E--D--G--G--G--G--R
GTCCCCCTTCAGCATCCCGAACAGCAGCAGCGGCCCGTACGGCTCGCAGGACTCGGTGCACAGCAGCCCTGAGGACGGCGGCGGCGGCCG
:::: ::::::::::::: ::.::::::::::::::::::::::::::::::::::: :::                             
GTCCACCTTCAGCATCCCCAATAGCAGCAGCGGCCCGTACGGCTCGCAGGACTCGGTTCAC                             
--S--T--F--S--I--P--N--S--S--S--G--P--Y--G--S--Q--D--S--V--H------------------------------

--D--R--P--V--G--G--S--P--G--G--P--R--L--V--I--G--S--L--P--A--H--L--S--P--H--M--F--G--
GGACCGGCCGGTGGGCGGGAGCCCCGGCGGGCCGCGCCTGGTGATCGGCTCCTTACCAGCTCACCTCTCGCCGCACATGTTTGGAG
                                                                                      
                                                                                      
--------------------------------------------------------------------------------------

BGISUSX0001025921 both Identity : 84.354%

                                                                                          
GCGGGCCACGTGCGGGAGGAGGGGCCGCCTTCTGGTTGGCGCCCGGTGTCCGTTCCTCCTATCGGCGTAGGCCCCGCGAGGAAGACAAGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCGCGCCCTGGCTGGGAGGGCGTGGCCAGAGACCTGTCCATCACCGAGTCCACGAGTGGCAGCACCTACCACACCGCAGTACCTTGGCGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGCGGAGCAGGGGCAGGCAGGTCGCGGAAGGGGGAGGCGGAGCAAGGCCGGCGGGAGCCAATCGGCCTGGCGGCACGAGGGGGCGGGGGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGGGTCAACGCGCGCGACCCAAACACACGGGCCGGGCGCACCCTGCAGCCGCGCCGCTCCGCGGCCTTCCGGCGCGGGGCCGGGGAACCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCTCCCCATCTGCGCACCCCCCGCCTTCGCGGCCCAGATCCTCCCGCCAGCCCGGCCCCTCCTTCGCAGGGGGAGCGAGGCGACGGTTGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CGGGAAGCGCGCGCCACCTCTCCCTCCCATTTTTCGTTCTCCCCTCGCGCGCCACCCGTTTTTCCTCTTTCTCCGTTAATAACAGCTGGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TGGCTGGGGGAGGAGGGAAGGTGGCCCCGGCGGAGTCTGGGCGGGCGCCTCCCACTCAGCCGCCAGCCGCCGTGGGAGCCGGAGGATGGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGCGGTAGCAGCGGCCGCCCGAGAGGAGGCGGTGCCGAGATCGGGGGCGCCGAGCGCGGCAGCAGAGAGCGGTAGCGGCCCGTCGTGGCG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CACCAGAACCGAAACCAGCGGCAGCCGCACGGCCACTTGAGCCGCCCCTTCCTGCTGGAGCCAGCGAGGGGTGCCTGCAGCCGGGACCCC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTCCTCTCCGCGTCTCCTCGTCTCCCGCGCCCGCGTCAGGCCGTCGGCCTCGCCCGCCGCCCCAAGAAGAGCGCGCCGGGCGCCGACTGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCCTCTGGACGCCGGGCGGCGGCCCTGGACGTGCGGGGGCCTCTCTGGGCCGGCCGCGGCGCCTGGGCCCTGCCCTCTAGCTCCCGCGCT
                                                                                          
                                                                                          
                                                                                          

                                                             -M--G--A--K--Q--S--G--P--A--A
CGCTCCCGCCCTCCCGGCTCTCGGGGCGCAGCGCGCGGGCCCGGCCCGGGGCAGGGCGGACATGGGCGCCAAACAGAGCGGCCCGGCCGC
                                                                                          
                                                                                          
                                                             -----------------------------

--A--N--G--R--T--R--A--Y--S--G--S--D--L--P--S--S--S--S--------G--G--A--N--G--T--A--G--G--G
CGCTAACGGCCGCACGCGCGCGTACTCGGGCTCGGATCTACCTTCCAGTAGCAGC------GGAGGCGCCAATGGGACCGCGGGCGGCGG
                   ::::::::::::::::::.::::::::::.::::::      ::::: :::::.::::::::.      ::
                   GCGTACTCGGGCTCGGATTTACCTTCCAGCAGCAGCAGCAGCGGAGGGGCCAACGGGACCGCA------GG
--------------------A--Y--S--G--S--D--L--P--S--S--S--S--S--S--G--G--A--N--G--T--A--------G

--G--G--A--R--A--A--A--A--G--R--F--P--A--Q--V--P--S--A--H--Q--P--S--A--S--G--G--A--A--A--A
CGGGGGCGCTCGGGCCGCCGCCGCGGGGAGGTTCCCGGCTCAGGTGCCCAGCGCGCACCAGCCCAGCGCCTCCGGCGGCGCCGCGGCGGC
:.: :: :: :::::::: ::::: :::::.:: :::::::::::::::.:::::::::::::.::::::::::::::::::::::::::
CAGCGGGGCGCGGGCCGCGGCCGCCGGGAGATTGCCGGCTCAGGTGCCCGGCGCGCACCAGCCTAGCGCCTCCGGCGGCGCCGCGGCGGC
--S--G--A--R--A--A--A--A--G--R--L--P--A--Q--V--P--G--A--H--Q--P--S--A--S--G--G--A--A--A--A

--A--A--A--P--A--A--P--A--A--P--R--S--R--S--L--G--G--A--V--G--S--V--A--S--G--A--R--A--A--Q
CGCGGCGGCCCCGGCAGCCCCGGCGGCCCCGCGCAGCCGCTCCCTCGGCGGGGCCGTGGGGAGCGTGGCGTCGGGGGCCCGCGCGGCGCA
: ::                  :::::::::::::::::::::::::::::::: :::::.: :::::::::::::::::::::::::::
CTCG------------------GCGGCCCCGCGCAGCCGCTCCCTCGGCGGGGCGGTGGGAACCGTGGCGTCGGGGGCCCGCGCGGCGCA
--S--------------------A--A--P--R--S--R--S--L--G--G--A--V--G--T--V--A--S--G--A--R--A--A--Q

--S--P--F--S--I--P--N--S--S--S--G--P--Y--G--S--Q--D--S--V--H--S--S--P--E--D--G--G--G--G---
GTCCCCCTTCAGCATCCCGAACAGCAGCAGCGGCCCGTACGGCTCGCAGGACTCGGTGCACAGCAGCCCTGAGGACGGCGGCGGCGGC--
:::: ::::::::::::: ::.::::::::::::::::::::::::::::::::::: ::::::::::: ::::::::::::::::::  
GTCCACCTTCAGCATCCCCAATAGCAGCAGCGGCCCGTACGGCTCGCAGGACTCGGTTCACAGCAGCCCGGAGGACGGCGGCGGCGGCGG
--S--T--F--S--I--P--N--S--S--S--G--P--Y--G--S--Q--D--S--V--H--S--S--P--E--D--G--G--G--G--G

--------------R--D--R--P--V--G--G--S--P--G--G--P--R--L--V--I--G--S--L--P--A--H--L--S--P--H
-------------CGGGACCGGCCGGTGGGCGGGAGCCCCGGCGGGCCGCGCCTGGTGATCGGCTCCTTACCAGCTCACCTCTCGCCGCA
              ::::::::::::.:::::::.:::::::::::::::::::::::::::::::.:::::::::::::::::::::::
CAGCGGCGGCGGCAGGGACCGGCCGGCGGGCGGGGGCCCCGGCGGGCCGCGCCTGGTGATCGGCTCTTTACCAGCTCACCTCTCGCCGCA
--S--G--G--G--R--D--R--P--A--G--G--G--P--G--G--P--R--L--V--I--G--S--L--P--A--H--L--S--P--H

--M--F--G--
CATGTTTGGAG
:::::::::: 
CATGTTTGGA 
--M--F--G--

BGISUSX0000033804 all Identity : 84.354%

                                                                                          
GCGGGCCACGTGCGGGAGGAGGGGCCGCCTTCTGGTTGGCGCCCGGTGTCCGTTCCTCCTATCGGCGTAGGCCCCGCGAGGAAGACAAGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GCGCGCCCTGGCTGGGAGGGCGTGGCCAGAGACCTGTCCATCACCGAGTCCACGAGTGGCAGCACCTACCACACCGCAGTACCTTGGCGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGCGGAGCAGGGGCAGGCAGGTCGCGGAAGGGGGAGGCGGAGCAAGGCCGGCGGGAGCCAATCGGCCTGGCGGCACGAGGGGGCGGGGGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGGGTCAACGCGCGCGACCCAAACACACGGGCCGGGCGCACCCTGCAGCCGCGCCGCTCCGCGGCCTTCCGGCGCGGGGCCGGGGAACCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCTCCCCATCTGCGCACCCCCCGCCTTCGCGGCCCAGATCCTCCCGCCAGCCCGGCCCCTCCTTCGCAGGGGGAGCGAGGCGACGGTTGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CGGGAAGCGCGCGCCACCTCTCCCTCCCATTTTTCGTTCTCCCCTCGCGCGCCACCCGTTTTTCCTCTTTCTCCGTTAATAACAGCTGGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TGGCTGGGGGAGGAGGGAAGGTGGCCCCGGCGGAGTCTGGGCGGGCGCCTCCCACTCAGCCGCCAGCCGCCGTGGGAGCCGGAGGATGGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGCGGTAGCAGCGGCCGCCCGAGAGGAGGCGGTGCCGAGATCGGGGGCGCCGAGCGCGGCAGCAGAGAGCGGTAGCGGCCCGTCGTGGCG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CACCAGAACCGAAACCAGCGGCAGCCGCACGGCCACTTGAGCCGCCCCTTCCTGCTGGAGCCAGCGAGGGGTGCCTGCAGCCGGGACCCC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTCCTCTCCGCGTCTCCTCGTCTCCCGCGCCCGCGTCAGGCCGTCGGCCTCGCCCGCCGCCCCAAGAAGAGCGCGCCGGGCGCCGACTGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCCTCTGGACGCCGGGCGGCGGCCCTGGACGTGCGGGGGCCTCTCTGGGCCGGCCGCGGCGCCTGGGCCCTGCCCTCTAGCTCCCGCGCT
                                                                                          
                                                                                          
                                                                                          

                                                             -M--G--A--K--Q--S--G--P--A--A
CGCTCCCGCCCTCCCGGCTCTCGGGGCGCAGCGCGCGGGCCCGGCCCGGGGCAGGGCGGACATGGGCGCCAAACAGAGCGGCCCGGCCGC
                                                                                          
                                                                                          
                                                             -----------------------------

--A--N--G--R--T--R--A--Y--S--G--S--D--L--P--S--S--S--S--------G--G--A--N--G--T--A--G--G--G
CGCTAACGGCCGCACGCGCGCGTACTCGGGCTCGGATCTACCTTCCAGTAGCAGC------GGAGGCGCCAATGGGACCGCGGGCGGCGG
                   ::::::::::::::::::.::::::::::.::::::      ::::: :::::.::::::::.      ::
                   GCGTACTCGGGCTCGGATTTACCTTCCAGCAGCAGCAGCAGCGGAGGGGCCAACGGGACCGCA------GG
--------------------A--Y--S--G--S--D--L--P--S--S--S--S--S--S--G--G--A--N--G--T--A--------G

--G--G--A--R--A--A--A--A--G--R--F--P--A--Q--V--P--S--A--H--Q--P--S--A--S--G--G--A--A--A--A
CGGGGGCGCTCGGGCCGCCGCCGCGGGGAGGTTCCCGGCTCAGGTGCCCAGCGCGCACCAGCCCAGCGCCTCCGGCGGCGCCGCGGCGGC
:.: :: :: :::::::: ::::: :::::.:: :::::::::::::::.:::::::::::::.::::::::::::::::::::::::::
CAGCGGGGCGCGGGCCGCGGCCGCCGGGAGATTGCCGGCTCAGGTGCCCGGCGCGCACCAGCCTAGCGCCTCCGGCGGCGCCGCGGCGGC
--S--G--A--R--A--A--A--A--G--R--L--P--A--Q--V--P--G--A--H--Q--P--S--A--S--G--G--A--A--A--A

--A--A--A--P--A--A--P--A--A--P--R--S--R--S--L--G--G--A--V--G--S--V--A--S--G--A--R--A--A--Q
CGCGGCGGCCCCGGCAGCCCCGGCGGCCCCGCGCAGCCGCTCCCTCGGCGGGGCCGTGGGGAGCGTGGCGTCGGGGGCCCGCGCGGCGCA
: ::                  :::::::::::::::::::::::::::::::: :::::.: :::::::::::::::::::::::::::
CTCG------------------GCGGCCCCGCGCAGCCGCTCCCTCGGCGGGGCGGTGGGAACCGTGGCGTCGGGGGCCCGCGCGGCGCA
--S--------------------A--A--P--R--S--R--S--L--G--G--A--V--G--T--V--A--S--G--A--R--A--A--Q

--S--P--F--S--I--P--N--S--S--S--G--P--Y--G--S--Q--D--S--V--H--S--S--P--E--D--G--G--G--G---
GTCCCCCTTCAGCATCCCGAACAGCAGCAGCGGCCCGTACGGCTCGCAGGACTCGGTGCACAGCAGCCCTGAGGACGGCGGCGGCGGC--
:::: ::::::::::::: ::.::::::::::::::::::::::::::::::::::: ::::::::::: ::::::::::::::::::  
GTCCACCTTCAGCATCCCCAATAGCAGCAGCGGCCCGTACGGCTCGCAGGACTCGGTTCACAGCAGCCCGGAGGACGGCGGCGGCGGCGG
--S--T--F--S--I--P--N--S--S--S--G--P--Y--G--S--Q--D--S--V--H--S--S--P--E--D--G--G--G--G--G

--------------R--D--R--P--V--G--G--S--P--G--G--P--R--L--V--I--G--S--L--P--A--H--L--S--P--H
-------------CGGGACCGGCCGGTGGGCGGGAGCCCCGGCGGGCCGCGCCTGGTGATCGGCTCCTTACCAGCTCACCTCTCGCCGCA
              ::::::::::::.:::::::.:::::::::::::::::::::::::::::::.:::::::::::::::::::::::
CAGCGGCGGCGGCAGGGACCGGCCGGCGGGCGGGGGCCCCGGCGGGCCGCGCCTGGTGATCGGCTCTTTACCAGCTCACCTCTCGCCGCA
--S--G--G--G--R--D--R--P--A--G--G--G--P--G--G--P--R--L--V--I--G--S--L--P--A--H--L--S--P--H

--M--F--G--
CATGTTTGGAG
:::::::::: 
CATGTTTGGA 
--M--F--G--