Exon Sequence
>ENSE00001415505 NT
TGTGTAAATTATAATGACCA
ACACCCTAATGGCTGGTATA
TC
>ENSE00001415505 AA
-CVNYNDQHPNGWYI

ENSE00001415505

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100