Exon Sequence
>ENSE00001417114 NT
ATGGCCGCAGGCGGCAGTGC
GCCCGAGCCCCGCGTCCTCG
TCTGCCTCGGGGCGCTCCTG
GCCGGCTGGGTCGCCGTA
>ENSE00001417114 AA
MAAGGSAPEPRVLVCLGALL
AGWVAV

ENSE00001417114

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100