Exon Sequence
>ENSE00001419081 NT
TTGGTGCTCTCGGACCTACC
ATGCGAAGAAGATGAA
>ENSE00001419081 AA
LVLSDLPCEEDE

ENSE00001419081

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100