Exon Sequence
>ENSE00001420000 NT
GGTATAATAGACTACATTTT
CTATTCTAAACCTCAGCTGA
ACACCTTAGGCATCCTGGGC
CCTCTGGACCACCACTGGCT
GGTTGAGAATAACATCAGTG
GCTGCCCGCACCCCCTCATC
CCCTCTGACCACTTCTCACT
TTTTGCACAACTGGAGCTCT
TACTGCCTTTCCTGCCCCAA
GTCAACGGCATCCACCTTCC
TGGCAGGAGGTAG
>ENSE00001420000 AA
GIIDYIFYSKPQLNTLGILG
PLDHHWLVENNISGCPHPLI
PSDHFSLFAQLELLLPFLPQ
VNGIHLPGRR*

ENSE00001420000

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003013860 reads Identity : 100%

-G--I--I--D--Y--I--F--Y--S--K--P--Q--L--N--T--L--G--I--L--G--P--L--D--H--H--W--L--V--E--N-
GGTATAATAGACTACATTTTCTATTCTAAACCTCAGCTGAACACCTTAGGCATCCTGGGCCCTCTGGACCACCACTGGCTGGTTGAGAAT
      :::::::::::.::::::::::::::::::::::::::.:::::::::::::: ::::::::::::::.:::::.:::::::::
      ATAGACTACATCTTCTATTCTAAACCTCAGCTGAACACTTTAGGCATCCTGGGACCTCTGGACCACCATTGGCTAGTTGAGAAT
-------I--D--Y--I--F--Y--S--K--P--Q--L--N--T--L--G--I--L--G--P--L--D--H--H--W--L--V--E--N-

-N--I--S--G--C--P--H--P--L--I--P--S--D--H--F--S--L--F--A--Q--L--E--L--L--L--P--F--L--P--Q-
AACATCAGTGGCTGCCCGCACCCCCTCATCCCCTCTGACCACTTCTCACTTTTTGCACAACTGGAGCTCTTACTGCCTTTCCTGCCCCAA
::.:::::.:: :::::.::::: :::::::::::.::::::::::::::::::::::::::::::::::::::::::::::::::::::
AATATCAGCGGATGCCCACACCCACTCATCCCCTCCGACCACTTCTCACTTTTTGCACAACTGGAGCTCTTACTGCCTTTCCTGCCCCAA
-N--I--S--G--C--P--H--P--L--I--P--S--D--H--F--S--L--F--A--Q--L--E--L--L--L--P--F--L--P--Q-

-V--N--G--I--H--L--P--G--R--R--*-                                                         
GTCAACGGCATCCACCTTCCTGGCAGGAGGTAGTCAAGCACCTTCAGAGGACAGCCTTGATTCACTTGTAAACTTGTGAAAATCTGAACA
::.::::::::.::.::::::                                                                     
GTTAACGGCATTCATCTTCCT                                                                     
-V--N--G--I--H--L--P-------------                                                         

                                                                                          
TAGGGGAGTGAGGTATGGCCACTGAGGATTTTTGCTTGCTTAAGAATGATTTGGACTTTCAATCTGATTATTTGATAAGGATATAGTATG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AAAGCCAGGTGCTAGCAACAGACAAATTCTGAGCCCAATATGCTTTATACTGCTAGACAGGGATTGGTGTGTTTGCACCTGTCTTTCATT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TGTCATAAGAGATTTTCCTATTTCTTCTACCCAATAGAATATTTTCATGCCTGGAAATAGGAAAATGTGTGAACAGCGTATTCTCTTCAC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
ACAGAAATCTGTAGCACTGCTTTTTTGAGGCCAGTAGCAACATCCAGAGATCATTCTTCCATACTTTACTCCCTCCTTTTTCAGACTTGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTGTAAAGTACAGAATCTGAATTTAGCCTTTATGATTGTATATGATCCACAGAAGACCTGATTTATGAAATTTTGTACTAAAATCATTTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GAAATGATTGTATTGTAAACTGAGGCTAAATTTTTTTTTAAACCTGTTTCATGTGTTATAAAGGCCAGCTTGTAAAAGAAGCTGCAACAG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
ACTTTCTCTGCTCATGATTTGCACTCTTAGGGTTTTGTTAGCCCTTTTGTACTACTTTCTTTTTAAATTGAGAACATGGTTCTTTACATA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TAAATCTGCTTCAACCTTAGGATGTTTTCAGACCAGAGGCAACTTATTCATGAATTTTTATGAAAACTATCTACTAGGACAGATAAGCTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AACAGTGATGATCTGTAGACATTTATGGACTGAATGTAATGGTTGATATATGTACATTCTGATATTTTTAAATCTTTAACTTTTTAAAGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TAAAAACCTACAGCTGCTTAGGTCCAGCTTCTTAACTCTTTTTGAGACACTTCCTGTCCTATCTCCACTGTGCCTGCCTAAATTTGTTCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CACCAAGCACTGCCTGTGCATGCAGAGAAAATCTGTGCATCCTCTTTTATATTTTTAAAATACTGTTTAACATTTGTGAGAATTTTATGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AAATGCTTTTGTATGAGCTGTGGCTTTTTCCCATTGTGAAGCATTGAATATCACATTTTGGAACATGTTATAGGGTGAGTCCCTGGATCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTGCTCACCAGATCCAAGCACTGCTTCTCGGTGTCATTGCAGTGTGCTGCTTGTCACCCAGAATACTACTATCATGTGAATTCTTTTTGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CGTCAGTGTCTTTTCCTTAGTCTTTTTGTTGTTGTTGTTGTTGTTGTTTTAATCATTCCTTTTTTAAGAAGAAGTAATTTTCCATTTATG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AAGCAGTATGAATTAGATGTATTTTCAAAACAGGTCCCTAAGACAATTCTTCAGATCATTTTTAAAATGACTAAGTCATTTTAGTATGTC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AAGCAAGATAAAAATTACATCATACCGTCTATTTTGCCCATAGTGCCATTTAGAGATGAAAACCAGCTTTAACTTTGCAAAGTGAACATG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TACATGGTCTGCTCTCATTTATTCATTCTTCTCTCAAAAGTCAAATGAATGCAGAGGGAGCTTGGTCAAACTGCTTTTGTTTCAACTGCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGCAGGGGAGCAAAAGGACGCCATGTGAGCATTAGGAAAAAAAATACTCACTCTTACTAACAATTTTTATACAGAAAATGAGTCATTTTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GAAATGATTCTTATGTTTTTTTTTTTTCTCCTTTTAGAAAATTCTCCAAAAGGTTTTGATGTTGAATCTTGGTCTTGGACCTGTTTTTTC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CTTTGAGGGTTTTTTGTTTTTTGTTTTTTCTAGGATTTCATTGTGATGTTTTGGTTTTGTTTTTTGCTTTTTGTTTAAGTTGTGCTGACA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCAAACACATCCAGTTTATAATCAGTACATTGGAAAGCTGGTATTGATGTAGAACCAGTGCATAACTTTTTATGGGGTTTTGTTATTGGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTTTTTTTGTAAAGTGTGAATAAAAGGTATGTTTACTCATTTTTCCTGAACACTGTGTTGGTAATGTGCATCATGACAATTTCCAGTGAA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGTGAGCTGGAGCTGGTTGGACTAATGAGACTGAGGAAGCAGCTTTTCCTACGATCTGCATTATGTAATCACAGGTCCAGAGAGCTTTAT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGAAGCGGGAGAGGAGGAGCACTTACTCATGTTGTATTTGTTAATGGAGGATGTCATCTTTTCATAGATGCTGGAACTAGAGTGCACTTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTAGATGCTAAAGGTTTGAGCTTTACACAAAATGTCTTCATCTGTATTTGTTATTGTCTACAATATATTTGAATTTGGGGCAGCATATTA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AGATGTAATGGCCTGTTATGTCTTGAAAATACTTGTTTTGCCTCTTCCAGGCATACTGCATTCTGTGGATCAGTTTGAACAGCTTCTCCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCTTATTTGGACAGTGATAAATTGAACCAAGAGTGTAGATTTACAAGTGTAACCTTCAAAAGAGGAAGAACTATTTGGGGTCTGTAGGTA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
ATGAACAGTCACACCAAAATAGACTATGATGCTTTTGTTAAGAAAGGTTTCATGTTTTAGATATTTTCCGTGTCCTAAATAATTTTCAAT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AATCTATAATCCCTAAAATGCAATAAAAACTAGTATGTTTTCACGGTGTATATTTTTTTTCAAAAATTCTGTAACAAATATATTTAATGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTTGCCATAATGTCATTTCAGTATTTTTGCTGGATAAATCCATTTTAGAAATGTCTTACAAAAAGTTTAGGGCATGTTTTCTGTTTTAAA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GACCAGAAGTTTGAAGGCACCCAAATCCTTGTCGCCAATCTCCTGAAGTACAGCTTTACCATATTAGTGGTCATTATTTATGCTTTGAGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTTTCAATATTGTTCGTCAAGTTAACTTATGGCATAATTTAAGCTAAAGTTGTAGAAATGAATTGTTGAGTGCAACTTTCATAGTCCCAA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AGATAGGCAGAGAACATCTCCAGAAATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTAATATGATTTAGTGACAACCAGGAAAACT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TACTTGGGATTATTAGCACTTTCAAACTTAGGGACATTATTAAATTGGATGGAATGCACTTCTAAATGTTTAAATTAAAATTTCAAAGCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CTTTCGAGATTCAGGTTCTCAATAATAATATTCAAGTTTTAGAGTTTCACTTTGTACTATTTAAATTTATGGAACTAGTTTCCATACTGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CTTGTAAGGTTTTGGGGTCATATATAAGGACTAAAGCCAAGCTAGGCAAAACAATGACAGCACCGTTTTTTCAGTGAAGCTCTCAGAATG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TCCAGTACAGATGTTGCAGATAATTCCAAGAACTCCTTCAGCAGGTGTTCTTCACCATTCGTAAACAGTATTTTAAGATGTTCACTTTGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TCTTCTTTTTGGTTACATACATTTTAATAACTGGTATGTTGAAGTAGTGTCTAAAAGTATCTAGTCTTTATTCACAGTACATTATATTGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTGATGCACTGGACTAACTCTTGTTTACCATTCATGTAACAAAACCCAGCACATTATCTGCACTATAAGCTCAAAGAATGTCACATCCGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCAGACAGCTCTTTGATGAGGGTGATGGGAACTGAATAAACCATACGGACTGGCAGTAACAAGGGCTTTTACTGTTCTGTTCAGTGGAAC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CTTCTTGGTCAAATTGTAATTAGCTAGCATTATATTTATATACAGGGTCTTTTTTCTTTACCGATGTATTTTCCTACTCATAGCCAACCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
ATAAATTCAGTATCTGTTTCAAATATTTTAGAAGTGTAGTTTGTATAGCTGTAGTACTGAGGTTTGAGGAAAAATAAATGTTGATCAGCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GACCACGTATTTAAAATTCTGAATCTTCTGGGACAGGGTTGTAACTCAGCCTTCCAAAGGGAAGAGTGCAGGGGGACGGGGCCATGATAT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGGGAAATGGTGTAAACTAATGTATTTCTTTATTGGCTGTTATTCTGTATAACACTCATATCTTTGCCAAAGTTCAATTTTATATTTAGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAACTGATGGTCCTTTTGCATTTAGGATTTTCGTTGTTGTTACCTTATACCTCATGATATAAGGAATGGGCTCATGTGTCTTCCGTCTTT
                                                                                          
                                                                                          
                                                                                          

                                          
TGGAAGGAGGTTGACATATTTTAAATAAATGCTTTTAAATAC
                                          
                                          
                                          

BGISUSX0001013968 both Identity : 100%

-G--I--I--D--Y--I--F--Y--S--K--P--Q--L--N--T--L--G--I--L--G--P--L--D--H--H--W--L--V--E--N-
GGTATAATAGACTACATTTTCTATTCTAAACCTCAGCTGAACACCTTAGGCATCCTGGGCCCTCTGGACCACCACTGGCTGGTTGAGAAT
      :::::::::::.::::::::::::::::::::::::::.:::::::::::::: ::::::::::::::.:::::.:::::::::
      ATAGACTACATCTTCTATTCTAAACCTCAGCTGAACACTTTAGGCATCCTGGGACCTCTGGACCACCATTGGCTAGTTGAGAAT
-------I--D--Y--I--F--Y--S--K--P--Q--L--N--T--L--G--I--L--G--P--L--D--H--H--W--L--V--E--N-

-N--I--S--G--C--P--H--P--L--I--P--S--D--H--F--S--L--F--A--Q--L--E--L--L--L--P--F--L--P--Q-
AACATCAGTGGCTGCCCGCACCCCCTCATCCCCTCTGACCACTTCTCACTTTTTGCACAACTGGAGCTCTTACTGCCTTTCCTGCCCCAA
::.:::::.:: :::::.::::: :::::::::::.::::::::::::::::::::::::::::::::::::::::::::::::::::::
AATATCAGCGGATGCCCACACCCACTCATCCCCTCCGACCACTTCTCACTTTTTGCACAACTGGAGCTCTTACTGCCTTTCCTGCCCCAA
-N--I--S--G--C--P--H--P--L--I--P--S--D--H--F--S--L--F--A--Q--L--E--L--L--L--P--F--L--P--Q-

-V--N--G--I--H--L--P--G--R--R--*-                                                         
GTCAACGGCATCCACCTTCCTGGCAGGAGGTAGTCAAGCACCTTCAGAGGACAGCCTTGATTCACTTGTAAACTTGTGAAAATCTGAACA
::.::::::::.::.::::::                                                                     
GTTAACGGCATTCATCTTCCT                                                                     
-V--N--G--I--H--L--P-------------                                                         

                                                                                          
TAGGGGAGTGAGGTATGGCCACTGAGGATTTTTGCTTGCTTAAGAATGATTTGGACTTTCAATCTGATTATTTGATAAGGATATAGTATG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AAAGCCAGGTGCTAGCAACAGACAAATTCTGAGCCCAATATGCTTTATACTGCTAGACAGGGATTGGTGTGTTTGCACCTGTCTTTCATT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TGTCATAAGAGATTTTCCTATTTCTTCTACCCAATAGAATATTTTCATGCCTGGAAATAGGAAAATGTGTGAACAGCGTATTCTCTTCAC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
ACAGAAATCTGTAGCACTGCTTTTTTGAGGCCAGTAGCAACATCCAGAGATCATTCTTCCATACTTTACTCCCTCCTTTTTCAGACTTGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTGTAAAGTACAGAATCTGAATTTAGCCTTTATGATTGTATATGATCCACAGAAGACCTGATTTATGAAATTTTGTACTAAAATCATTTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GAAATGATTGTATTGTAAACTGAGGCTAAATTTTTTTTTAAACCTGTTTCATGTGTTATAAAGGCCAGCTTGTAAAAGAAGCTGCAACAG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
ACTTTCTCTGCTCATGATTTGCACTCTTAGGGTTTTGTTAGCCCTTTTGTACTACTTTCTTTTTAAATTGAGAACATGGTTCTTTACATA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TAAATCTGCTTCAACCTTAGGATGTTTTCAGACCAGAGGCAACTTATTCATGAATTTTTATGAAAACTATCTACTAGGACAGATAAGCTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AACAGTGATGATCTGTAGACATTTATGGACTGAATGTAATGGTTGATATATGTACATTCTGATATTTTTAAATCTTTAACTTTTTAAAGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TAAAAACCTACAGCTGCTTAGGTCCAGCTTCTTAACTCTTTTTGAGACACTTCCTGTCCTATCTCCACTGTGCCTGCCTAAATTTGTTCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CACCAAGCACTGCCTGTGCATGCAGAGAAAATCTGTGCATCCTCTTTTATATTTTTAAAATACTGTTTAACATTTGTGAGAATTTTATGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AAATGCTTTTGTATGAGCTGTGGCTTTTTCCCATTGTGAAGCATTGAATATCACATTTTGGAACATGTTATAGGGTGAGTCCCTGGATCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTGCTCACCAGATCCAAGCACTGCTTCTCGGTGTCATTGCAGTGTGCTGCTTGTCACCCAGAATACTACTATCATGTGAATTCTTTTTGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CGTCAGTGTCTTTTCCTTAGTCTTTTTGTTGTTGTTGTTGTTGTTGTTTTAATCATTCCTTTTTTAAGAAGAAGTAATTTTCCATTTATG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AAGCAGTATGAATTAGATGTATTTTCAAAACAGGTCCCTAAGACAATTCTTCAGATCATTTTTAAAATGACTAAGTCATTTTAGTATGTC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AAGCAAGATAAAAATTACATCATACCGTCTATTTTGCCCATAGTGCCATTTAGAGATGAAAACCAGCTTTAACTTTGCAAAGTGAACATG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TACATGGTCTGCTCTCATTTATTCATTCTTCTCTCAAAAGTCAAATGAATGCAGAGGGAGCTTGGTCAAACTGCTTTTGTTTCAACTGCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGCAGGGGAGCAAAAGGACGCCATGTGAGCATTAGGAAAAAAAATACTCACTCTTACTAACAATTTTTATACAGAAAATGAGTCATTTTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GAAATGATTCTTATGTTTTTTTTTTTTCTCCTTTTAGAAAATTCTCCAAAAGGTTTTGATGTTGAATCTTGGTCTTGGACCTGTTTTTTC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CTTTGAGGGTTTTTTGTTTTTTGTTTTTTCTAGGATTTCATTGTGATGTTTTGGTTTTGTTTTTTGCTTTTTGTTTAAGTTGTGCTGACA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCAAACACATCCAGTTTATAATCAGTACATTGGAAAGCTGGTATTGATGTAGAACCAGTGCATAACTTTTTATGGGGTTTTGTTATTGGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTTTTTTTGTAAAGTGTGAATAAAAGGTATGTTTACTCATTTTTCCTGAACACTGTGTTGGTAATGTGCATCATGACAATTTCCAGTGAA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGTGAGCTGGAGCTGGTTGGACTAATGAGACTGAGGAAGCAGCTTTTCCTACGATCTGCATTATGTAATCACAGGTCCAGAGAGCTTTAT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGAAGCGGGAGAGGAGGAGCACTTACTCATGTTGTATTTGTTAATGGAGGATGTCATCTTTTCATAGATGCTGGAACTAGAGTGCACTTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTAGATGCTAAAGGTTTGAGCTTTACACAAAATGTCTTCATCTGTATTTGTTATTGTCTACAATATATTTGAATTTGGGGCAGCATATTA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AGATGTAATGGCCTGTTATGTCTTGAAAATACTTGTTTTGCCTCTTCCAGGCATACTGCATTCTGTGGATCAGTTTGAACAGCTTCTCCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCTTATTTGGACAGTGATAAATTGAACCAAGAGTGTAGATTTACAAGTGTAACCTTCAAAAGAGGAAGAACTATTTGGGGTCTGTAGGTA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
ATGAACAGTCACACCAAAATAGACTATGATGCTTTTGTTAAGAAAGGTTTCATGTTTTAGATATTTTCCGTGTCCTAAATAATTTTCAAT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AATCTATAATCCCTAAAATGCAATAAAAACTAGTATGTTTTCACGGTGTATATTTTTTTTCAAAAATTCTGTAACAAATATATTTAATGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTTGCCATAATGTCATTTCAGTATTTTTGCTGGATAAATCCATTTTAGAAATGTCTTACAAAAAGTTTAGGGCATGTTTTCTGTTTTAAA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GACCAGAAGTTTGAAGGCACCCAAATCCTTGTCGCCAATCTCCTGAAGTACAGCTTTACCATATTAGTGGTCATTATTTATGCTTTGAGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTTTCAATATTGTTCGTCAAGTTAACTTATGGCATAATTTAAGCTAAAGTTGTAGAAATGAATTGTTGAGTGCAACTTTCATAGTCCCAA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AGATAGGCAGAGAACATCTCCAGAAATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTAATATGATTTAGTGACAACCAGGAAAACT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TACTTGGGATTATTAGCACTTTCAAACTTAGGGACATTATTAAATTGGATGGAATGCACTTCTAAATGTTTAAATTAAAATTTCAAAGCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CTTTCGAGATTCAGGTTCTCAATAATAATATTCAAGTTTTAGAGTTTCACTTTGTACTATTTAAATTTATGGAACTAGTTTCCATACTGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CTTGTAAGGTTTTGGGGTCATATATAAGGACTAAAGCCAAGCTAGGCAAAACAATGACAGCACCGTTTTTTCAGTGAAGCTCTCAGAATG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TCCAGTACAGATGTTGCAGATAATTCCAAGAACTCCTTCAGCAGGTGTTCTTCACCATTCGTAAACAGTATTTTAAGATGTTCACTTTGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TCTTCTTTTTGGTTACATACATTTTAATAACTGGTATGTTGAAGTAGTGTCTAAAAGTATCTAGTCTTTATTCACAGTACATTATATTGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTGATGCACTGGACTAACTCTTGTTTACCATTCATGTAACAAAACCCAGCACATTATCTGCACTATAAGCTCAAAGAATGTCACATCCGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCAGACAGCTCTTTGATGAGGGTGATGGGAACTGAATAAACCATACGGACTGGCAGTAACAAGGGCTTTTACTGTTCTGTTCAGTGGAAC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CTTCTTGGTCAAATTGTAATTAGCTAGCATTATATTTATATACAGGGTCTTTTTTCTTTACCGATGTATTTTCCTACTCATAGCCAACCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
ATAAATTCAGTATCTGTTTCAAATATTTTAGAAGTGTAGTTTGTATAGCTGTAGTACTGAGGTTTGAGGAAAAATAAATGTTGATCAGCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GACCACGTATTTAAAATTCTGAATCTTCTGGGACAGGGTTGTAACTCAGCCTTCCAAAGGGAAGAGTGCAGGGGGACGGGGCCATGATAT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGGGAAATGGTGTAAACTAATGTATTTCTTTATTGGCTGTTATTCTGTATAACACTCATATCTTTGCCAAAGTTCAATTTTATATTTAGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAACTGATGGTCCTTTTGCATTTAGGATTTTCGTTGTTGTTACCTTATACCTCATGATATAAGGAATGGGCTCATGTGTCTTCCGTCTTT
                                                                                          
                                                                                          
                                                                                          

                                          
TGGAAGGAGGTTGACATATTTTAAATAAATGCTTTTAAATAC
                                          
                                          
                                          

BGISUSX0000018357 all Identity : 100%

-G--I--I--D--Y--I--F--Y--S--K--P--Q--L--N--T--L--G--I--L--G--P--L--D--H--H--W--L--V--E--N-
GGTATAATAGACTACATTTTCTATTCTAAACCTCAGCTGAACACCTTAGGCATCCTGGGCCCTCTGGACCACCACTGGCTGGTTGAGAAT
      :::::::::::.::::::::::::::::::::::::::.:::::::::::::: ::::::::::::::.:::::.:::::::::
      ATAGACTACATCTTCTATTCTAAACCTCAGCTGAACACTTTAGGCATCCTGGGACCTCTGGACCACCATTGGCTAGTTGAGAAT
-------I--D--Y--I--F--Y--S--K--P--Q--L--N--T--L--G--I--L--G--P--L--D--H--H--W--L--V--E--N-

-N--I--S--G--C--P--H--P--L--I--P--S--D--H--F--S--L--F--A--Q--L--E--L--L--L--P--F--L--P--Q-
AACATCAGTGGCTGCCCGCACCCCCTCATCCCCTCTGACCACTTCTCACTTTTTGCACAACTGGAGCTCTTACTGCCTTTCCTGCCCCAA
::.:::::.:: :::::.::::: :::::::::::.::::::::::::::::::::::::::::::::::::::::::::::::::::::
AATATCAGCGGATGCCCACACCCACTCATCCCCTCCGACCACTTCTCACTTTTTGCACAACTGGAGCTCTTACTGCCTTTCCTGCCCCAA
-N--I--S--G--C--P--H--P--L--I--P--S--D--H--F--S--L--F--A--Q--L--E--L--L--L--P--F--L--P--Q-

-V--N--G--I--H--L--P--G--R--R--*-                                                         
GTCAACGGCATCCACCTTCCTGGCAGGAGGTAGTCAAGCACCTTCAGAGGACAGCCTTGATTCACTTGTAAACTTGTGAAAATCTGAACA
::.::::::::.::.::::::                                                                     
GTTAACGGCATTCATCTTCCT                                                                     
-V--N--G--I--H--L--P-------------                                                         

                                                                                          
TAGGGGAGTGAGGTATGGCCACTGAGGATTTTTGCTTGCTTAAGAATGATTTGGACTTTCAATCTGATTATTTGATAAGGATATAGTATG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AAAGCCAGGTGCTAGCAACAGACAAATTCTGAGCCCAATATGCTTTATACTGCTAGACAGGGATTGGTGTGTTTGCACCTGTCTTTCATT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TGTCATAAGAGATTTTCCTATTTCTTCTACCCAATAGAATATTTTCATGCCTGGAAATAGGAAAATGTGTGAACAGCGTATTCTCTTCAC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
ACAGAAATCTGTAGCACTGCTTTTTTGAGGCCAGTAGCAACATCCAGAGATCATTCTTCCATACTTTACTCCCTCCTTTTTCAGACTTGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTGTAAAGTACAGAATCTGAATTTAGCCTTTATGATTGTATATGATCCACAGAAGACCTGATTTATGAAATTTTGTACTAAAATCATTTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GAAATGATTGTATTGTAAACTGAGGCTAAATTTTTTTTTAAACCTGTTTCATGTGTTATAAAGGCCAGCTTGTAAAAGAAGCTGCAACAG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
ACTTTCTCTGCTCATGATTTGCACTCTTAGGGTTTTGTTAGCCCTTTTGTACTACTTTCTTTTTAAATTGAGAACATGGTTCTTTACATA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TAAATCTGCTTCAACCTTAGGATGTTTTCAGACCAGAGGCAACTTATTCATGAATTTTTATGAAAACTATCTACTAGGACAGATAAGCTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AACAGTGATGATCTGTAGACATTTATGGACTGAATGTAATGGTTGATATATGTACATTCTGATATTTTTAAATCTTTAACTTTTTAAAGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TAAAAACCTACAGCTGCTTAGGTCCAGCTTCTTAACTCTTTTTGAGACACTTCCTGTCCTATCTCCACTGTGCCTGCCTAAATTTGTTCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CACCAAGCACTGCCTGTGCATGCAGAGAAAATCTGTGCATCCTCTTTTATATTTTTAAAATACTGTTTAACATTTGTGAGAATTTTATGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AAATGCTTTTGTATGAGCTGTGGCTTTTTCCCATTGTGAAGCATTGAATATCACATTTTGGAACATGTTATAGGGTGAGTCCCTGGATCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTGCTCACCAGATCCAAGCACTGCTTCTCGGTGTCATTGCAGTGTGCTGCTTGTCACCCAGAATACTACTATCATGTGAATTCTTTTTGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CGTCAGTGTCTTTTCCTTAGTCTTTTTGTTGTTGTTGTTGTTGTTGTTTTAATCATTCCTTTTTTAAGAAGAAGTAATTTTCCATTTATG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AAGCAGTATGAATTAGATGTATTTTCAAAACAGGTCCCTAAGACAATTCTTCAGATCATTTTTAAAATGACTAAGTCATTTTAGTATGTC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AAGCAAGATAAAAATTACATCATACCGTCTATTTTGCCCATAGTGCCATTTAGAGATGAAAACCAGCTTTAACTTTGCAAAGTGAACATG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TACATGGTCTGCTCTCATTTATTCATTCTTCTCTCAAAAGTCAAATGAATGCAGAGGGAGCTTGGTCAAACTGCTTTTGTTTCAACTGCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGCAGGGGAGCAAAAGGACGCCATGTGAGCATTAGGAAAAAAAATACTCACTCTTACTAACAATTTTTATACAGAAAATGAGTCATTTTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GAAATGATTCTTATGTTTTTTTTTTTTCTCCTTTTAGAAAATTCTCCAAAAGGTTTTGATGTTGAATCTTGGTCTTGGACCTGTTTTTTC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CTTTGAGGGTTTTTTGTTTTTTGTTTTTTCTAGGATTTCATTGTGATGTTTTGGTTTTGTTTTTTGCTTTTTGTTTAAGTTGTGCTGACA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCAAACACATCCAGTTTATAATCAGTACATTGGAAAGCTGGTATTGATGTAGAACCAGTGCATAACTTTTTATGGGGTTTTGTTATTGGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTTTTTTTGTAAAGTGTGAATAAAAGGTATGTTTACTCATTTTTCCTGAACACTGTGTTGGTAATGTGCATCATGACAATTTCCAGTGAA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGTGAGCTGGAGCTGGTTGGACTAATGAGACTGAGGAAGCAGCTTTTCCTACGATCTGCATTATGTAATCACAGGTCCAGAGAGCTTTAT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGAAGCGGGAGAGGAGGAGCACTTACTCATGTTGTATTTGTTAATGGAGGATGTCATCTTTTCATAGATGCTGGAACTAGAGTGCACTTG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TTAGATGCTAAAGGTTTGAGCTTTACACAAAATGTCTTCATCTGTATTTGTTATTGTCTACAATATATTTGAATTTGGGGCAGCATATTA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AGATGTAATGGCCTGTTATGTCTTGAAAATACTTGTTTTGCCTCTTCCAGGCATACTGCATTCTGTGGATCAGTTTGAACAGCTTCTCCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCTTATTTGGACAGTGATAAATTGAACCAAGAGTGTAGATTTACAAGTGTAACCTTCAAAAGAGGAAGAACTATTTGGGGTCTGTAGGTA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
ATGAACAGTCACACCAAAATAGACTATGATGCTTTTGTTAAGAAAGGTTTCATGTTTTAGATATTTTCCGTGTCCTAAATAATTTTCAAT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AATCTATAATCCCTAAAATGCAATAAAAACTAGTATGTTTTCACGGTGTATATTTTTTTTCAAAAATTCTGTAACAAATATATTTAATGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTTGCCATAATGTCATTTCAGTATTTTTGCTGGATAAATCCATTTTAGAAATGTCTTACAAAAAGTTTAGGGCATGTTTTCTGTTTTAAA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GACCAGAAGTTTGAAGGCACCCAAATCCTTGTCGCCAATCTCCTGAAGTACAGCTTTACCATATTAGTGGTCATTATTTATGCTTTGAGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTTTCAATATTGTTCGTCAAGTTAACTTATGGCATAATTTAAGCTAAAGTTGTAGAAATGAATTGTTGAGTGCAACTTTCATAGTCCCAA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
AGATAGGCAGAGAACATCTCCAGAAATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTAATATGATTTAGTGACAACCAGGAAAACT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TACTTGGGATTATTAGCACTTTCAAACTTAGGGACATTATTAAATTGGATGGAATGCACTTCTAAATGTTTAAATTAAAATTTCAAAGCT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CTTTCGAGATTCAGGTTCTCAATAATAATATTCAAGTTTTAGAGTTTCACTTTGTACTATTTAAATTTATGGAACTAGTTTCCATACTGA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CTTGTAAGGTTTTGGGGTCATATATAAGGACTAAAGCCAAGCTAGGCAAAACAATGACAGCACCGTTTTTTCAGTGAAGCTCTCAGAATG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TCCAGTACAGATGTTGCAGATAATTCCAAGAACTCCTTCAGCAGGTGTTCTTCACCATTCGTAAACAGTATTTTAAGATGTTCACTTTGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
TCTTCTTTTTGGTTACATACATTTTAATAACTGGTATGTTGAAGTAGTGTCTAAAAGTATCTAGTCTTTATTCACAGTACATTATATTGT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GTGATGCACTGGACTAACTCTTGTTTACCATTCATGTAACAAAACCCAGCACATTATCTGCACTATAAGCTCAAAGAATGTCACATCCGC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CCAGACAGCTCTTTGATGAGGGTGATGGGAACTGAATAAACCATACGGACTGGCAGTAACAAGGGCTTTTACTGTTCTGTTCAGTGGAAC
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CTTCTTGGTCAAATTGTAATTAGCTAGCATTATATTTATATACAGGGTCTTTTTTCTTTACCGATGTATTTTCCTACTCATAGCCAACCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
ATAAATTCAGTATCTGTTTCAAATATTTTAGAAGTGTAGTTTGTATAGCTGTAGTACTGAGGTTTGAGGAAAAATAAATGTTGATCAGCA
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GACCACGTATTTAAAATTCTGAATCTTCTGGGACAGGGTTGTAACTCAGCCTTCCAAAGGGAAGAGTGCAGGGGGACGGGGCCATGATAT
                                                                                          
                                                                                          
                                                                                          

                                                                                          
GGGGAAATGGTGTAAACTAATGTATTTCTTTATTGGCTGTTATTCTGTATAACACTCATATCTTTGCCAAAGTTCAATTTTATATTTAGG
                                                                                          
                                                                                          
                                                                                          

                                                                                          
CAACTGATGGTCCTTTTGCATTTAGGATTTTCGTTGTTGTTACCTTATACCTCATGATATAAGGAATGGGCTCATGTGTCTTCCGTCTTT
                                                                                          
                                                                                          
                                                                                          

                                          
TGGAAGGAGGTTGACATATTTTAAATAAATGCTTTTAAATAC
                                          
                                          
                                          

BGISUSX0000018358 all Identity : 92.308%

-G--I--I--D--Y--I--F--Y--S--K--P--Q--L--N--T--L--G--I--L--G--P--L--D--H--H--W--L--V--E--N-
GGTATAATAGACTACATTTTCTATTCTAAACCTCAGCTGAACACCTTAGGCATCCTGGGCCCTCTGGACCACCACTGGCTGGTTGAGAAT
   ::::: ::::::::.:::::::::::::::::: :::::