Exon Sequence
>ENSE00001425399 NT
ATGGAGACCTCAGCACTCAA
GCAGCAGGAGCAGCCCGCGG
CGACCAAGATCAGGAACCTG
CCC
>ENSE00001425399 AA
METSALKQQEQPAATKIRNL
P

ENSE00001425399

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100

BGISUSX0003040188 reads Identity : 80.952%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                 ::: ::::::::::.: :::::::::: ::::::::: :::.:::::::::::::::
                                 ATGCAGACCTCAGCGCACAAGCAGCAGCAGCAGCCCGAGGCAACCAAGATCAGGAAC
                                 -M--Q--T--S--A--H--K--Q--Q--Q--Q--P--E--A--T--K--I--R--N-

-L--P---
CTGCCCTG
::::::  
CTGCCC  
-L--P---

BGISUSX0002063585 est Identity : 80.952%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                 ::: ::::::::::.: :::::::::: ::::::::: :::.:::::::::::::::
                                 ATGCAGACCTCAGCGCACAAGCAGCAGCAGCAGCCCGAGGCAACCAAGATCAGGAAC
                                 -M--Q--T--S--A--H--K--Q--Q--Q--Q--P--E--A--T--K--I--R--N-

-L--P---
CTGCCCTG
::::::  
CTGCCC  
-L--P---

BGISUSX0002063586 est Identity : 80.952%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                 ::: ::::::::::.: :::::::::: ::::::::: :::.:::::::::::::::
                                 ATGCAGACCTCAGCGCACAAGCAGCAGCAGCAGCCCGAGGCAACCAAGATCAGGAAC
                                 -M--Q--T--S--A--H--K--Q--Q--Q--Q--P--E--A--T--K--I--R--N-

-L--P---
CTGCCCTG
::::::  
CTGCCC  
-L--P---

BGISUSX0001042220 both Identity : 80.952%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                 ::: ::::::::::.: :::::::::: ::::::::: :::.:::::::::::::::
                                 ATGCAGACCTCAGCGCACAAGCAGCAGCAGCAGCCCGAGGCAACCAAGATCAGGAAC
                                 -M--Q--T--S--A--H--K--Q--Q--Q--Q--P--E--A--T--K--I--R--N-

-L--P---
CTGCCCTG
::::::  
CTGCCC  
-L--P---

BGISUSX0000054971 all Identity : 80.952%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                 ::: ::::::::::.: :::::::::: ::::::::: :::.:::::::::::::::
                                 ATGCAGACCTCAGCGCACAAGCAGCAGCAGCAGCCCGAGGCAACCAAGATCAGGAAC
                                 -M--Q--T--S--A--H--K--Q--Q--Q--Q--P--E--A--T--K--I--R--N-

-L--P---
CTGCCCTG
::::::  
CTGCCC  
-L--P---

BGISUSX0000054972 all Identity : 80.952%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                 ::: ::::::::::.: :::::::::: ::::::::: :::.:::::::::::::::
                                 ATGCAGACCTCAGCGCACAAGCAGCAGCAGCAGCCCGAGGCAACCAAGATCAGGAAC
                                 -M--Q--T--S--A--H--K--Q--Q--Q--Q--P--E--A--T--K--I--R--N-

-L--P---
CTGCCCTG
::::::  
CTGCCC  
-L--P---

BGISUSX0003040189 reads Identity : 80%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                 ::: ::::::::::.: :::::::::: ::::::::: :::.:::::::::::::::
                                 ATGCAGACCTCAGCGCACAAGCAGCAGCAGCAGCCCGAGGCAACCAAGATCAGGAAC
                                 -M--Q--T--S--A--H--K--Q--Q--Q--Q--P--E--A--T--K--I--R--N-

-L--P---
CTGCCCTG
:::     
CTG     
-L------

BGISUSX0001042219 both Identity : 80%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                 ::: ::::::::::.: :::::::::: ::::::::: :::.:::::::::::::::
                                 ATGCAGACCTCAGCGCACAAGCAGCAGCAGCAGCCCGAGGCAACCAAGATCAGGAAC
                                 -M--Q--T--S--A--H--K--Q--Q--Q--Q--P--E--A--T--K--I--R--N-

-L--P---
CTGCCCTG
:::     
CTG     
-L------

BGISUSX0000054973 all Identity : 80%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                 ::: ::::::::::.: :::::::::: ::::::::: :::.:::::::::::::::
                                 ATGCAGACCTCAGCGCACAAGCAGCAGCAGCAGCCCGAGGCAACCAAGATCAGGAAC
                                 -M--Q--T--S--A--H--K--Q--Q--Q--Q--P--E--A--T--K--I--R--N-

-L--P---
CTGCCCTG
:::     
CTG     
-L------

BGISUSX0003040188 reads Identity : 42.857%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                                                     :: ::   .. : : :::  .
                                                                     GCTGCTTGTGCGCTGAGGTCT
                                 -------------------------------------A--A--C--A--L--R--S-

-L--P---
CTGCCCTG
        
        
--------

BGISUSX0003040189 reads Identity : 42.857%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                                                     :: ::   .. : : :::  .
                                                                     GCTGCTTGTGCGCTGAGGTCT
                                 -------------------------------------A--A--C--A--L--R--S-

-L--P---
CTGCCCTG
        
        
--------

BGISUSX0002063585 est Identity : 42.857%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                                                     :: ::   .. : : :::  .
                                                                     GCTGCTTGTGCGCTGAGGTCT
                                 -------------------------------------A--A--C--A--L--R--S-

-L--P---
CTGCCCTG
        
        
--------

BGISUSX0002063586 est Identity : 42.857%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                                                     :: ::   .. : : :::  .
                                                                     GCTGCTTGTGCGCTGAGGTCT
                                 -------------------------------------A--A--C--A--L--R--S-

-L--P---
CTGCCCTG
        
        
--------

BGISUSX0001042219 both Identity : 42.857%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                                                     :: ::   .. : : :::  .
                                                                     GCTGCTTGTGCGCTGAGGTCT
                                 -------------------------------------A--A--C--A--L--R--S-

-L--P---
CTGCCCTG
        
        
--------

BGISUSX0001042220 both Identity : 42.857%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                                                     :: ::   .. : : :::  .
                                                                     GCTGCTTGTGCGCTGAGGTCT
                                 -------------------------------------A--A--C--A--L--R--S-

-L--P---
CTGCCCTG
        
        
--------

BGISUSX0000054971 all Identity : 42.857%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                                                     :: ::   .. : : :::  .
                                                                     GCTGCTTGTGCGCTGAGGTCT
                                 -------------------------------------A--A--C--A--L--R--S-

-L--P---
CTGCCCTG
        
        
--------

BGISUSX0000054972 all Identity : 42.857%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                                                     :: ::   .. : : :::  .
                                                                     GCTGCTTGTGCGCTGAGGTCT
                                 -------------------------------------A--A--C--A--L--R--S-

-L--P---
CTGCCCTG
        
        
--------

BGISUSX0000054973 all Identity : 42.857%

                                                                                          
GAGTTGCTTTTGCGCGCGAACTGTAAGTGCCAGGGTCTCAGGGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGAT
                                                                                          
                                                                                          
                                                                                          

                                 -M--E--T--S--A--L--K--Q--Q--E--Q--P--A--A--T--K--I--R--N-
CTCAGCGGATCTGGTCACCTTCGTCTCCCCGCCATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAAC
                                                                     :: ::   .. : : :::  .
                                                                     GCTGCTTGTGCGCTGAGGTCT
                                 -------------------------------------A--A--C--A--L--R--S-

-L--P---
CTGCCCTG
        
        
--------