Oligo BGISUSO0000000004

Oligo nameBGISUSO0000000004
GeneSH3GL3
TM75.02
SequenceCGTGGTCTCTATGACTTTGAGCCAGAAAACCAAGGAGAACTAGGATTTAAAGAAGGGGAC