Oligo BGISUSO0000000006

Oligo nameBGISUSO0000000006
GeneAMACR
TM75.7
SequenceCCCAGCCGTCCCATCCTCTGAAAGAAATCCCTTTGTAGGAGAACATACAGAAGAGATACT