Oligo BGISUSO0000000008

Oligo nameBGISUSO0000000008
GeneZNF263
TM79.8
SequenceGAGCGGCGAGGAAGCGGTGACTCTTGTGGAAGATATGCAGAAAGAGCTTGGGAGGCTGAG