Oligo BGISUSO0000000009

Oligo nameBGISUSO0000000009
GeneNP_775821.2
TM82.53
SequenceTGCACCTGGAGACCTTTGCAATGGAGGGGCTCAAGGGCGGGCCAGAGGTTGTAGCGTGCC