Oligo BGISUSO0000000011

Oligo nameBGISUSO0000000011
GeneBACH1
TM77.75
SequenceAGCAGTGTCGCCAGAGTGGTGGCATCTCGGATTTCTGTCAGCAGATGACCGACAAATGTA