Oligo BGISUSO0000000012

Oligo nameBGISUSO0000000012
GeneANGPTL2
TM79.12
SequenceGAGGAGGCTCCTACTCGCTCAAGAAAGTGGTGATGATGATACGGCCCAACCCCAACACCT