Oligo BGISUSO0000000013

Oligo nameBGISUSO0000000013
GeneHDGF
TM79.8
SequenceGAAGGAGTATAAATGCGGGGACCTGGTGTTCGCCAAGATGAAGGGCTACCCACACTGGCC