Oligo BGISUSO0000000015

Oligo nameBGISUSO0000000015
GeneCCL27
TM79.8
SequenceAAGCTACTGAGGCAGATCATCCGGGTGGAACTGCAGGAAGCTGATGGGGACTGTCACCTC