Oligo BGISUSO0000000018

Oligo nameBGISUSO0000000018
GeneEHD4
TM80.48
SequenceTCCGCAGAAGGCGGCGGTGCGTAAACTCAATGACCTCATCAAGCGAGCCAGGTTGGCCAA