Oligo BGISUSO0000000021

Oligo nameBGISUSO0000000021
GeneLMCD1
TM80.48
SequenceGGCCGGGCATACATCATCACCAAGGGTCAGCTTCTGTGCCCGACGTGCAGCAAGTCCAAA