Oligo BGISUSO0000000022

Oligo nameBGISUSO0000000022
GeneTP53I3
TM77.75
SequenceGCCCATGTGTATATGGAGACTAACAGGAACATGGGCAAAATCGTCCTGGAGCTGCCCCAA