Oligo BGISUSO0000000024

Oligo nameBGISUSO0000000024
GeneDTNA
TM79.8
SequenceCGTGAACCTTTGCATCCCATGTTCCCCGACCAGCCTGAGAAACCACTCAACTTGGCCCAC