Oligo BGISUSO0000000029

Oligo nameBGISUSO0000000029
GenePLXNB1
TM79.12
SequenceAGCTGGGCTATCGGCTCCAGCAGATCGCAGCAGCTGTGGAAAACAAAGTCACGGATCTCT