Oligo BGISUSO0000000052

Oligo nameBGISUSO0000000052
GeneNP_116236.1
TM74.33
SequenceAGGTGGTTCAGAAAGATCAAAGACCACTTCTGTCCCTCTGAAAATCACTTCCATACAGAG