Oligo BGISUSO0000000055

Oligo nameBGISUSO0000000055
GeneNARG1
TM73.65
SequenceATGCTTTGGCTTTCATGCCTCCTGGATATGAAGAGGATATGAAGATCACAGTTAATGGAG