Oligo BGISUSO0000000056

Oligo nameBGISUSO0000000056
GeneSRGAP1
TM81.17
SequenceAAACAAACCCTGCCATGGGACCTGCCCCACCTCCCCAGGGTCCAGCAGACAAGTCTTGCA